Answer:
What Keene High school students are you reading about? And what scientist are you talking about? If you had given more information I would have helped. Anyways, just look at what it says in the book that the scientist did, and what the Keene high school students did. And see what they both have in common.
More water means more pee (theoretically). Pee is actually just garbage materials from the body (toxins). These color the urine. The more you drink, the more you have to pee and just pee clean because all toxins are out, or you have more water to take out the toxins, having less of it per let's say 0.5 l
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Answer is Calvin cycle.
Explanation:
Calvin cycle is very important to plants because it helps in the conversion of organic products for the usefulness of plants. This is because the carbon dioxide and water are converted to glucose, which is useful to plants.
Calvin cycle can be explained as the production of glucose through the use of chemical energy from NADPH and ATP, produced in light reactions, to convert the atmospheric carbon dioxide to RuBP, which is a five-carbon molecule.
C because limiting factor can’t grow to it’s biotic!