1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zinaida [17]
3 years ago
6

Why do different kinds of control mechanisms exist?

Biology
1 answer:
Nadya [2.5K]3 years ago
4 0
<h2>(c) is Right Answer</h2>

Explanation:

    (c) is Right Answer.

  1. A<em> </em>repressor is a DNA-or RNA-restricting protein that restrains the outflow of at least one qualities by authoritative to the operator or associated silencers.
  2. A RNA-restricting repressor ties to the mRNA and forestalls interpretation of the mRNA into protein. This hindering of articulation is called repression.
  3. Transcribing a gene, RNA polymerase ties to the DNA of the quality at an area called the promoter.
  4. It contains acknowledgment locales for RNA polymerase or its aide proteins to tie to.
  5. The DNA opens up in the advertiser district with the goal that RNA <em>polymerase can start translation.  </em>
  6. Interpretation factors are an exceptionally assorted group of proteins and by and large capacity in multi-subunit protein edifices.
  7. They may tie legitimately to <em>uncommon “promoter” locales of DNA, </em>which lie upstream of the coding area in a <em>quality, or straightforwardly to the RNA polymerase atom.</em>
You might be interested in
How was the scientists work similar to the work of the Keene high school students
Usimov [2.4K]

Answer:

What Keene High school students are you reading about? And what scientist are you talking about? If you had given more information I would have helped. Anyways, just look at what it says in the book that the scientist did, and what the Keene high school students did. And see what they both have in common.

5 0
3 years ago
How can water intake affect the volume and concentration of urine?
Alchen [17]
More water means more pee (theoretically). Pee is actually just garbage materials from the body (toxins). These color the urine. The more you drink, the more you have to pee and just pee clean because all toxins are out, or you have more water to take out the toxins, having less of it per let's say 0.5 l
3 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
A researcher uses a radioactively-labeled carbon dioxide molecule to evaluate photosynthetic rate. In her experiments, the resea
Vedmedyk [2.9K]

Answer:

Answer is Calvin cycle.

Explanation:

Calvin cycle is very important to plants because it helps in the conversion of organic products for the usefulness of plants. This is because the carbon dioxide and water are converted to glucose, which is useful to plants.

Calvin cycle can be explained as the production of glucose through the use of chemical energy from NADPH and ATP, produced in light reactions, to convert the atmospheric carbon dioxide to RuBP, which is a five-carbon molecule.

5 0
3 years ago
Sometimes a population cannot grow to its biotic potential due to environmental conditions called ____________.
strojnjashka [21]
C because limiting factor can’t grow to it’s biotic!





8 0
2 years ago
Read 2 more answers
Other questions:
  • Paramecium feeds by pinocytosis.<br> T or F?
    15·1 answer
  • Identify all the amino acid-specifying codons where a point mutation (a single base change) could generate a nonsense codon.
    12·1 answer
  • A randomly generated list of numbers from 0 to 4 is being used to simulate an event, with the numbers 2, 3, and 4 representing a
    6·1 answer
  • Pee wee herman's shoulders and waist are almost exactly the same width, so he is an example of which body type?
    7·1 answer
  • _____ is the primary excitatory neurotransmitter whereas _____ is the primary inhibitory neurotransmitter in the brain
    5·1 answer
  • Which of these statements is not true of the nucleolus? which of these statements is not true of the nucleolus? it contains fibr
    8·2 answers
  • The law of reflection states that if the angle of incidence is 38 degrees, the angle of reflection is ___ degrees.
    8·1 answer
  • Which phrase BEST describes the function of the ATP molecule?
    8·1 answer
  • Invasive species are one of the major threats to blodiversity. These species multiply quickly and compete with native species fo
    6·1 answer
  • 15. A student is given the single strand DNA sequence below. Following the sequence from left
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!