1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
3 years ago
12

After a volcanic eruption, ecosystems undergo a series of events known as succession. A study done by ecologists on Mount St. He

lens concludes that primary succession occurs when lupines are able to enrich the soil. Lupines are a nitrogen-fixing plant well adapted to colonizing sterilized ecosystems. However, the progression of the lupine is slowed by a certain predatory caterpillar. What would be the MOST successful strategy for ensuring succession in an area where lupines and the caterpillars both colonize?
A) introduce a controlled fire to begin secondary succession

B) move the caterpillar populations to a different area

C) spread lupine seeds to increase the density of growth

D) replace the lupines with another type of plant
Biology
1 answer:
Degger [83]3 years ago
7 0
The correct option is C.
From the information given above, it can be seen that, the caterpillar is a predator of the lupine plant. In order to ensure successful succession in the environment, the best thing to do is to increase the density of growth of the lupine plant, so that there will still be enough lupine plant to enrich the soil even though the caterpillar is feeding on them.
You might be interested in
Transmission of microbes by direct contact includes: a.drinking contaminated water. b.touching a contaminated countertop. c.inha
Romashka [77]

Answer:

B is correct

Explanation:

5 0
2 years ago
This doesnt have the dropdowns?
castortr0y [4]

Answer:

thats weird contact your teacher if you have anymore issues:)

Explanation:

bye friend

3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
What does erosion do to landforms and to sediment
Alborosie
Erosion can de-form/ruin landforms, & for sediment, it can erupt the rock cycle.

Hope this helped! :D
6 0
3 years ago
A graph with a calibration curve, linear regression and extrapolation was drawn up from your lab results. What were the two type
fiasKO [112]

Answer:

X is the concentration of the substance being measured and Y is the response from the instrument that is being used to measure

Explanation:

A calibration curve is the plot of known concentration of substances where x is the increasing known concentration and Y is the response, typically "absorption" taken from the instrument that is used for measuring. This curve is then used to find out the concentration of the unknown substance by using it's absorbance and comparing it with the calibration curve. For example:

Concentrations and absorbance readings are as follows

0.5mg/mL=10 nm

1.0mg/mL=15nm

1.5mg/mL=20nm

2.0mg/mL=25nm

This data is plotted on a calibration curve. Next we measure the unknown substance the absorption is 20nm. We can suggest that the concentration is 1.5 mg/mL. If there are readings that fall inbetwen values then the formulat to calculate the right concentration would be y = mx + b, where m is the slope and b is the y-intercept.

Linear regression uses the modification of the slope formula y= a + bx to best see how the data of the water samples would fit on the slope of the calibration curve. X is the independent variable , b is the slope of the line and a is the y-intercept.

Extrapolation would be the action of calculating data that are outside the calibration curve,  assuming the trend would continue.

7 0
3 years ago
Other questions:
  • Under what environmental condition would we expect euglena to ingest food rather than produce food via photosynthesis?
    12·1 answer
  • Cells perform many functions in living organisms. Which of the following processes occur in cells?
    8·2 answers
  • How do ecologists ues modeling?
    13·1 answer
  • Which part of a lab report would most likely show a line graph of the data collected?
    7·2 answers
  • The neuromuscular junction is a connection between a neuron and a __________.
    7·1 answer
  • Read the passage about the fluoridation of drinking water.
    6·1 answer
  • What is Thomas Edisons feild of specialty
    13·2 answers
  • Choose all that apply.
    12·1 answer
  • Is made to represent a real object or system<br> Map<br> Chart<br> Table<br> Line graph<br> Model
    6·1 answer
  • Much of the coordination of vertebrate body functions via chemical signals is accomplished by the ________.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!