1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
luda_lava [24]
3 years ago
6

Most organisms on earth get energy from the sun to your body. How does energy flow from the sun to your body?

Biology
1 answer:
slamgirl [31]3 years ago
3 0

Answer:

Energy is transferred from the sun to Earth via electromagnetic waves, or radiation. The heat you feel in your body is the suns energy entering your body from the energy transfers that happen when you move.

Explanation:

Most of the energy that passes through the upper atmosphere and reaches Earth's surface is in two forms, visible and infrared light. The heat you feel in your body results from the energy transfers that happen when you move. When you sweat, your body expends energy to cool itself down. A food chain shows how energy flows from one organism to another. In general, energy flows from the Sun to producers and then to consumers.

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Cole is making a pedigree chart for the dogs that he breeds. His chart will have shaded shapes to show dogs who carry the domina
nadya68 [22]
You could do this: do the same shape but one shaded and one not
To show that female expressed that trait
Hope this helps you

3 0
4 years ago
Read 2 more answers
8. Morgan used_____crosses to study a new pattern of inheritance.​
neonofarm [45]

Pretty sure he used female gametes

4 0
3 years ago
How many cells are present after 80mins
frutty [35]

There are about 16 cells present after 80mins.

4 0
3 years ago
Read 2 more answers
What is the evidence to support the idea that hormones involved in the menstrual cycle do not significantly influence womenâs se
ohaa [14]
<span>Menopause has little impact on a woman's sexual interest and activity</span>
6 0
4 years ago
Other questions:
  • How does the circulatory and digestive systems work together?
    13·2 answers
  • Which is a living component of a desert in California
    8·1 answer
  • To reiterate instructions A. mediae on B. confuse C. explain D. repeat E. revise
    7·2 answers
  • Which trait would best indicate that a particular arthropod was a member of subphylum chelicerata?
    13·1 answer
  • Biology is the study of the atmosphere. <br> a. True<br> b. False
    9·1 answer
  • Which of the following best describes the pattern of microbial death? Which of the following best describes the pattern of micro
    15·1 answer
  • How a renewable resource can run out?
    14·1 answer
  • Explain, why only plants cells have chloroplasts but both plants and animals have mitochondria.
    5·1 answer
  • Ozone depletion can have negative
    8·1 answer
  • Can dogs regulate their body temperature?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!