First blank is barb fish
And the second blank is newts
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
The answer should be 4. All of the above.
<h2>Mutation & genetic drift</h2>
Explanation:
- A mutation is characterized as a lasting change to the DNA succession in a quality. This change moves the hereditary message conveyed by the quality and can modify the amino corrosive arrangement of the protein the quality encodes. This implies future cells created by the quality will just convey a specific characteristic.
- Genetic Drift is the change in the hereditary structure of a populace after some time because of possibility or irregular occasions. In instances of hereditary float, for example, catastrophic events or periods of irregular climate, the age that makes due to repeat won't really be the fittest, yet the most fortunate. Hereditary float doesn't allude to a particular change in hereditary cells, rather to arbitrary events that impact a population's genetic makeup.
- Hence, the right answer of the fill up the blank is "mutation and genetic drift".
