1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sliva [168]
3 years ago
12

Why can an exogenous protein, protein that is added by experimentalists that has the same amino acid sequence as endogenous prot

ein, be resistant to RNA interference while the endogenous protein is susceptible to RNA interference?
(A) The genetic code is degenerate, meaning that there is more than one codon for a single amino acid.
(B) The exogenous protein consists of introns rendering the exogenous protein resistant.
(C) The endogenous protein contains introns which is why its susceptible to RNA interference.
(D) The genetic code is degenerate, meaning that there is only one codon for a single amino acid.
Biology
1 answer:
Anna11 [10]3 years ago
8 0

Answer:

(A) The genetic code is degenerate, meaning that there is more than one codon for a single amino acid.

Explanation:

RNA interference occurs when small single-stranded RNA molecules inhibit the expression of the mRNA having a sequence complementary to them. The sequence of mRNA is read in the form of triplets during the process of translation. The base triplets make the genetic code and specify amino acids to be added to the protein. One genetic code specifies a particular amino acid but some amino acids have more than one genetic code, that is, the genetic code is degenerate.

Therefore, an exogenous protein with the same amino acid sequence as that of the endogenous protein may be resistant to the RNA interference as its mRNA has alternative genetic codes for the same amino acid. For example, if mRNA with "GCU" code is susceptible to RNA interference, the mRNA with GCA may be resistant to it. Though both specify the amino acid alanine.

You might be interested in
The Miller-Urey experiment simulated compounds present in the atmosphere of early Earth, lightning, and the evaporation and cond
levacccp [35]

Answer:

The Miller-Urey experiment was conducted to simulate the conditions on Earth when life arose, and see if a chemical evolution could occur. This experiment was performed without oxygen, because they knew that if oxygen was added, the amino acids would oxidize. In particular, the experiment intended to simulate a volcanic eruption was analyzed.

Thus, particles of water, methane, ammonia and hydrogen were exposed to high temperatures and electric discharges that simulated these eruptions, during a determined period. Later, it was observed that organic compounds had emerged from this exposure, which allowed us to infer one of the hypotheses regarding the origin of life on Earth.

8 0
2 years ago
Which of these is the balanced equation for this reaction
VikaD [51]

A is your answer.  it cant be B because H doesn't equal 2 on both sides.it cant be C because S doesn't equal 3 on both sides of the equation . It also cant be D because Au doesn't equal 3 on the first part of the equation so your best answer is A. Hope this helps!!!!

8 0
3 years ago
Read 2 more answers
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
How does food provide energy and matter for organisms?​
svlad2 [7]

Answer:

Food provides the molecules that serve as fuel and building material for all organisms. Plants use the energy from light to make sugars from carbon dioxide and water. ... Organisms Explanation:

7 0
2 years ago
Which of these had the highest level of biodiversity?
Ierofanga [76]

Answer:

should be the deciduous forest

Explanation:

3 0
2 years ago
Read 2 more answers
Other questions:
  • 8 Natural selection produces changes most quickly in
    12·1 answer
  • From memory, list the characteristics of life.
    10·2 answers
  • What portion of the ocean contains the highest biodiversity and the greatest productivity?
    11·1 answer
  • PLZ HELP Will also give brainliest 1.What is DNA? Why is it important to every living thing?
    7·1 answer
  • State one possible negative impact of importing a natural predator to control a pest
    14·1 answer
  • How would you expect prey to respond to a predator they have never encountered before (a novel predator)? explain your reasoning
    13·2 answers
  • What was the main purpose of the declaration of independence
    11·1 answer
  • The cell plate is formed during ____?
    14·1 answer
  • Which of the following is found in the 'rungs' of a DNA strand?
    8·1 answer
  • HELP! WILL GIVE BRANLIEST! (Question 4)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!