1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hichkok12 [17]
3 years ago
7

Which statement describes the availability of carbon in the ocean and its use by marine processes? (3 points)

Biology
1 answer:
olchik [2.2K]3 years ago
4 0

The ocean is a carbon sink, with carbon being utilized by photosynthesis of phytoplankton describes the availability of carbon in the ocean and its use by marine processes

The ocean is a carbon sink, with carbon being utilized by photosynthesis of phytoplankton.

<u>Explanation:</u>

The carbon is found in the ocean is utilized by the phytoplankton found in the ocean. The carbon sinks in the ocean and then the process of photosynthesis required the carbon dioxide and the sunlight.

The ocean plays an important role in the carbon cycle, the carbon spreads in the ocean are called the ocean sink because it takes up more carbon from the atmosphere. The chemical and biological processes influence the carbon  by producing more carbon dioxide in the atmosphere.

You might be interested in
When endometrial tissue implants in the pelvic cavity this is called?
Katen [24]
Endometriosis

This occurs when the tissue that lines the womb called endometrium proliferates to other regions outside the uterus. The displaced endometrium is still subject to reproductive hormonal changes such as thickening and breakdown as it occurs in the womb. This causes complications with painful symptoms. 
4 0
4 years ago
This is a mass that remains at the original site and can be surgically removed
77julia77 [94]

Answer:

maybe B

Explanation:

7 0
4 years ago
Read 2 more answers
¿Por qué el jugo pancreático tiene bicarbonato de sodio?
Nezavi [6.7K]

Answer:

en los jugos pancreáticos hay bicarbonato de sodio que neutraliza la alta acidez.

3 0
3 years ago
Are you likley to find zooplanton in the aphotic, benthric zone of a ocean
likoan [24]
No. Zooplankton feed on phytoplankton. Phytoplankton cannot photosynthesize in the dark. (The Benthric Zone is the lowest level of the ocean/a body of water, no sunlight can really reach there.)
7 0
3 years ago
One difference between cancer cells and normal cells is that cancer cells (A) are unable to synthesize DNA. (B) are arrested at
Leona [35]

One difference between cancer cells and normal cells is that cancer cells continue to divide even when they are tightly packed together (option C).

<h3>What are cancer cells?</h3>

Cancer is a disease in which the cells of a tissue undergo uncontrolled (and often rapid) proliferation.

When normal cells become cancerous, they lose the ability to regulate cell division, hence, they continue to divide excessively.

Normal cells are characterized by their ability to regulate cell division during the cell cycle.

Therefore, one difference between cancer cells and normal cells is that cancer cells continue to divide even when they are tightly packed together.

Learn more about cancer cells at: brainly.com/question/436553

#SPJ1

5 0
2 years ago
Other questions:
  • Stem cells have the ability to divide and produce unspecified cells. They can be developed into a required tissue because of the
    14·2 answers
  • What does the chloroplast produce during the light independent reactions of photosynthesis?
    9·1 answer
  • A three letter sequence of MRNA that encodes for a specific amino acid is called a/an. A series of these links specific amino ac
    12·1 answer
  • Which type of limiting factor does the seasonal drought in the serengeti plains affect
    15·1 answer
  • What type of protein is missing in the blue people of KY?​
    7·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • According to the theory of plate tectonics what drives the motion of the contenients
    15·2 answers
  • Scientific investigations often lead to the formulation of new scientific questions. The observations Charles Darwin's work afte
    11·2 answers
  • Normal red blood cells slide easily through narrow blood vessels. In sickle cell disease, many red blood cells change to a cresc
    7·1 answer
  • Which of the following represents a population?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!