1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Likurg_2 [28]
4 years ago
10

Elena is making a grape drink

Biology
1 answer:
e-lub [12.9K]4 years ago
6 0
I’m not sure what your telling us lol , buh grape is good :)
You might be interested in
Would this be the answer??
Virty [35]
It's the first one is the answer
7 0
3 years ago
How is the process in which the ice melts?
Tatiana [17]

Explanation:

it is an endothermic process

Hope I helped

3 0
3 years ago
A vibration that produces that wave takes 5 Seconds to complete what is the frequency of the wave
DiKsa [7]
The answer using the formula f=1/T is f=1/5 which is 0.2hertz
8 0
3 years ago
6. How are the processes of mitosis and meiosis similar to each other?
Vsevolod [243]
The start from an are of high concentration to an area of low concentration until it's evenly spread out
8 0
3 years ago
What happens first when the amount of sunlight decreases?
dezoksy [38]
Light energy absorbed by chlorophyll is converted into chemical energy. Some of this energy is used to split water into hydrogen and oxygen. Some of the chemical energy is used to make ATP from ADP and phosphate (Pi). This chemical energy is stored as ATP.
5 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Why do tissues team up to form organs
    5·2 answers
  • A zoologist has been studying the annual migration of a species over a period of years. He missed the annual event on two occasi
    14·2 answers
  • What are three ways global warming can affect water cycle
    13·1 answer
  • Which organisms are the most diverse forms of life?
    9·1 answer
  • In what region of the United States are there the greatest percentage of farms? A. West B. North Central C. South D. Northeast
    9·2 answers
  • Which of the following describes an
    5·1 answer
  • A frameshift mutation will change a.Only one codon b.Only two codons c.All codons both before and after the point at which the m
    7·1 answer
  • Where are earthquakes MOST LIKELY to occur?
    7·2 answers
  • What happens to a cell when it becomes cancerous ?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!