1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex_Xolod [135]
4 years ago
15

Difference between plant and animal Glycolysis

Biology
1 answer:
Hoochie [10]4 years ago
6 0

Answer:

no difference

Explanation:

There is no difference between plant and animal glycolysis. Glycolysis is an important step of respiration and refers to the break down of glucose molecule for the generation of energy in the form of ATP. Both plant and animal glycolysis occurs in the cytoplasm of the cell where glucose molecule is broken down and produces 2 molecules of pyruvate and 2 molecule of ATP. This process occurs without the use of oxygen molecule.

You might be interested in
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
In a scientific
Murrr4er [49]

Answer:

B: About 3 or 4

Explanation:

4 0
3 years ago
A geologist finds rocks with dinosaur fossils. What is most likely the approximate age of the rocks in which the dinosaur fossil
AfilCa [17]
I would GUESS C. 70 million yrs old
5 0
3 years ago
Read 2 more answers
How does the central vacuole contribute to the support of the plant?
IrinaVladis [17]
The central vacuole holds all of the water for the plant, and when the plant has had enough water, it swells. When the central vacuole swells with all of the water, it pushes against the cell wall. This is called turgor pressure, and it gives the plant the support it needs to stay upright.
4 0
4 years ago
If exponential growth occurs in the population of a species of predator, the population of its prey will most likely ?
Sedbober [7]

Answer:

decrease quickly

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following breaks down the Ozone Layer when combined with cold and light?
    9·1 answer
  • A man has blood type O, Rh negative. These are both recessive traits. He is married to a woman who has blood type A, Rh positive
    8·1 answer
  • Whats the salient of desert the organism known too- causie the disease?
    5·1 answer
  • In figure 1, which symbol (unshaded square or shaded circle) represents the number of wildebeest, and which represents the perce
    8·1 answer
  • A long folded tube inside the body attached to the stomach where nutrients in the food are absorbed is ________
    5·1 answer
  • What was Charles Darwin’s contribution to the theory of evolution?
    7·2 answers
  • The atmospheric temperature decreases when snow starts melting because the snow from the atmosphere to melt.
    9·1 answer
  • Ephedrine and amphedamine  _________________________<br><br><br>​
    5·1 answer
  • 7. Why do plants need nitrate ions?
    6·1 answer
  • What characteristic of a microscope enables one to switch from one objective to another?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!