1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ale4655 [162]
4 years ago
14

The shuffling of chromosomes that occurs during both fertilization and _____ can lead to genetic variation.

Biology
1 answer:
Anton [14]4 years ago
6 0
The shuffling of chromosomes that occurs during both fertilization and meiosis can lead to genetic variation. This is because of the independent assortment and crossing over. Hope this answers the question. Have a nice day. Feel free to ask more questions.
You might be interested in
Stem cells may prove useful in the treatment of Type 1 diabetes because
timama [110]
Because they can be differentiated to form insulin-producing cells
5 0
3 years ago
Coaches will often urge athletes to exercise when they have a cold or other infection. What is the immunological reasoning behin
damaskus [11]

Exercise is the primary advice the coaches give to the athletes if they get a cold or any other infection. The main reason behind this advice is the fact that exercising strengthens the immunity of a person. When a person has an infection, the strengthening of the immune system will help his body to efficiently fight against the infectious pathogens. The blood circulation is increased which is involved in the enhancement of the acute immunity of the person.

3 0
3 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
Sasha doesn’t want to risk losing her house or car when she invests in her new business, so she decides to incorporate, which
rjkz [21]
The situation in which Sasha decides to incorporate without the risk losing her house or car is known as limited liability. Limited liability means that y<span>ou risk what you put in. So, if the business fails,</span> Sasha will be <span>not responsible for all of its debts and she will keep her car and house.</span>
8 0
3 years ago
What is the explaination of power
OlgaM077 [116]
Power is the rate (energy amount per time period) at which work is done or energy converted.
5 0
3 years ago
Other questions:
  • If a cell is having trouble regulating water levels, it is probably lacking inorganic compounds know as .
    6·2 answers
  • Which is a factor that determines whether a molecule can cross a cell
    15·2 answers
  • PLEASE HELP ASAP I DONT KNOW THIS. My teacher neverrrrr went over this
    15·1 answer
  • The four stages of cellular respiration do not function independently. Instead, they function ______
    8·1 answer
  • You have been asked to write a research paper by your science teacher on the topic of lunar eclipses. The teacher suggests using
    14·2 answers
  • What type of photoreceptor cell allows us to see gray tones in dim light, and provides our peripheral vision
    8·1 answer
  • What happens in people that have this difference in their DNA?
    10·1 answer
  • WILL MARK BRANLIEST PLS HELP
    15·2 answers
  • HELP ME BROOOO PLEASE
    12·1 answer
  • Arrange these groups in order from most inclusive (most general) to least inclusive (most specific).
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!