Answer:
Mutation is important as the first step of evolution because it creates a new DNA sequence for a particular gene, creating a new allele.
Explanation:
Answer:
Positive natural selection.
Explanation:
The positive natural selection is a type of natural selection that increases the frequency of an allele or trait when it is advantageous for the population. What happened in the example is that the mouth with the slight change in morphology (trait) was more advantageous for the population in the south in relation to the ancestral morphology (still preserved in the population in the north), and therefore its frequency increased. This, in turn, is due to the fact that the food (prey) is not the same in the two habitats (north and south). The specific prey in the south, caused the new morphology to be selected, (increasing the frequency of individuals with the new mouth), becasue probably that trait allows the trouts in the south to hunt more effectively.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Comparative with a wide range of variables
Answer:
I am assuming that the mutant cells have mutated beta galactosidase activity hence the relative levels of enzymatic activity would be reduced.
