1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lera25 [3.4K]
3 years ago
10

What kind of organelle do cells that secrete a substance have more of than other cells with a different function

Biology
1 answer:
pashok25 [27]3 years ago
4 0
Ornament peace center pout would tu conprend c fasil on le voylkan
You might be interested in
Early coal miners used canaries in cages as an early warning system to detect dangerous air
blagie [28]

Answer:

Because the Arctic glacier is crucial in cooling the land.

Explanation:

The glaciers contained in the Arctic are essential for cooling the earth's climate, which is why Arctic conditions are so important in determining the earth's climate changes.

These glaciers reflect about 80% of the sunlight in the northern hemisphere, and can cool the region's climate. If Arctic glaciers melt, most of the sun's rays will be absorbed by the ocean, increase the temperature and increase the melting of the glaciers.

As a result, the entire ecosystem will be damaged.

5 0
3 years ago
The molecule that uses the information stored in DNA to make proteins is _________.
lana [24]
The answer is B. RNA
8 0
3 years ago
Using recombinant DNA technology the gene for temperature resistance in fish is inserted into strawberries. These genetically mo
Lisa [10]

Answer:

Transgenic

Explanation:

Recombinant DNA technology is used to make transgenic organisms. Genetic material from one specie is inserted into the genome of another thus modifying its characteristics. There are several ways of doing this including electroporation and transduction. This process is referred to as genetic engineering.

7 0
3 years ago
How does the author support the statement that the laws of stratigraphy help
adell [148]
B. By using specific examples of inferences that could be made using two laws of stratigraphy
8 0
2 years ago
Read 2 more answers
The rhythmic contractions of the stomach and intestine that propel food along are called
Usimov [2.4K]
The rhythmic contractions of the stomach and food along the alimentary canal is called peristalsis
4 0
2 years ago
Other questions:
  • I NEED HELP!!!<br><br> Explain what is meant by a polar molecule.
    5·2 answers
  • for a common bacterial gene with a promoter, match each mutation to its most likely effect. Increased rate of transcription Decr
    6·1 answer
  • what is a situation where an environmental factor that could influence natural selection and decrease genetic diversity?
    12·1 answer
  • PLS HELP!!! NEED THIS DONE ASAP!! WILL VOTE BRAINIEST
    5·2 answers
  • What is a major benefit of schooling
    6·2 answers
  • _____ is an inquiry process that begins with a theory, prediction, or general principle that is then tested through data collect
    7·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What does the term "complementary" mean in base-pairing?
    13·2 answers
  • What happens to energy from the sun as it travels
    11·2 answers
  • How does ATP provide energy for living organisms?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!