1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GREYUIT [131]
3 years ago
5

Describes glucose (C6H12O6)?

Biology
1 answer:
saul85 [17]3 years ago
5 0
Is a simple sugar and it’s an important source for energy in many carbohydrates
You might be interested in
Which of the following terms refers to bloodstains that are not visible to the naked eye?
ANTONII [103]
The answer to your question 6loodstain Pattern Analysis
3 0
3 years ago
Read 2 more answers
Which statement best describes the relationship of photosynthesis and energy?
atroni [7]

Answer:

The correct answer is The process of photosynthesis is energy storing reaction because the process converts light energy into chemical energy which is stored in the bonds of glucose.

Explanation:

Photosynthesis is an important pathway occur in the mesophyll tissue of leaves of plants . Photosynthesis helps in formation of glucose molecule that is stored as polysaccharide starch inside the plant"s body.

       During photosynthesis light energy is captured from sun by the antenna complex of photosystem then the light energy is transferred to the reaction center for its conversion into chemical energy in form of ATP molrcules.

     The so formed ATP molecules helps in the biosynthesis of glucose by various enzyme catalyzed reactions.

4 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
What is the difference between forward spatter and back spatter?
pashok25 [27]
Forward spatter is the blood that is ejected out of the exit wound,going the same direction as the bullet.back spatter is the blood ejected out of the entry wound,travelling against the line of fire and towards the shooter.
4 0
3 years ago
Why is it important to understand the process of scientific discovery?
Mice21 [21]
Scientific discovery allows us to develop new technologies, solve practical problems, and make informed decisions — both individually and collectively.
6 0
2 years ago
Other questions:
  • Mice eat corn. hawks eat mice. what is the source of all the energy in this food chain?
    5·2 answers
  • The spinal cord is a vital part of our body.explain​
    15·2 answers
  • The placing of information or objects into groups based on certain similarities is
    9·1 answer
  • People who lose weight rapidly are more likely to regain the weight, leading to repeated cycles of weight loss and gain.
    15·2 answers
  • What makes metals like copper conductive to electricity
    7·1 answer
  • The notrogen cycle could not exist without what?​
    14·1 answer
  • Which of the following is a renewable resource?
    6·2 answers
  • How is the carbon cycle related to global warming ?
    6·1 answer
  • Can you solve this?<br> . 6÷2(1+2)=<br> :)
    10·1 answer
  • The backbone vertebrae, skull, and rib cage make up the _______ skeleton. Among other types of cells, bone marrow produces _____
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!