1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SOVA2 [1]
4 years ago
12

Which of the following statements about gel electrophoresis is correct?a. Longer DNA fragments migrate farther than shorter frag

mentsb. Migration distance is inversely proportional to the fragment sizec. Positively charged DNA migrates more rapidly than negatively charged DNAd. None of these statements are true
Biology
1 answer:
hram777 [196]4 years ago
3 0

Migration distance is inversely proportional to the fragment size.

<h3><u>Explanation</u>:</h3>

The gel electrophoresis is the process of separation of the DNA fragments after the action of restriction endonuclease action on enzyme. The gel electrophoresis is carried out after coating the DNA fragments with suitable salts and placing them on the side of the electrophoresis table.

The electrophoresis is carried through agar agar gel which has a network inside it.  The smaller DNA fragments will pass more through the gel whereas the larger fragments will be left behind.

You might be interested in
Researchers who have studied color blindness and color deficiency have found that a total color blindness is extremely rare in a
Schach [20]

Answer:

Option-B

Explanation:

Color deficiency is a condition caused when the person is not able to distinguish the different colors. Since the person is not able to distinguish different color, therefore, the chromo-receptors which are affected are the cone cells located in the retina which allows us to see different wavelengths.

1. Total color blindness is not a rare disease in animals.

2. Total color blindness in which a person is not able to see any color occurs when all types of cone cells become malfunction or completely absent.

3. The red-green color blindness is more common than the blue-yellow color blindness.

4. The mother is usually not affected as she is the carrier of the gene responsible for the color blindness.

Since all options except Option-2 are incorrect therefore option-2 is the correct answer.

7 0
3 years ago
Chlorofluorocarbons (CFCs) are a problem because they
Anna71 [15]
I think the best answer is D
3 0
3 years ago
What is a nucleoplasm in a plant cell
BartSMP [9]
 The nucleoplasm<span> is a type of protoplasm that is made up mostly of water, a mixture of various molecules, and dissolved ions.</span>
5 0
3 years ago
Read 2 more answers
Most fossils are found in what type of rock?
erastovalidia [21]
I believe the answer is D. Sedimentary 
7 0
4 years ago
Read 2 more answers
The IA allele encodes for the production of ____________ antigen, the IB allele encodes for ____________ antigen production and
scoray [572]

The IA allele encodes the A blood group antigen, IB allele encodes B, whereas, i encodes O blood group antigen.

<h3>What is antigen?</h3>

Any substance that causes the body to make an immune response against foreign substance. Antigens include toxins, chemicals, bacteria, viruses etc that come from outside the body.

So we can conclude that the IA allele encodes the A blood group antigen, IB allele encodes B, whereas, i encodes O blood group antigen.

Learn more about antigen here: brainly.com/question/7597406

4 0
3 years ago
Other questions:
  • 2 The electromagnetic spectrum is made of all the electromagnetic waves that are emitted from the Sun. Other objects in the univ
    12·2 answers
  • What is different about the secondary, tertiary, and quaternary structure of each protein?
    9·1 answer
  • Do the two chromosomes in a pair have the same genes lined up in the ''same order'', or not ?
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Evolution occurs when nature selects:
    15·2 answers
  • Digital coding shows that a simple code can transmit complex information. How do you think that idea might relate to genetic inf
    9·1 answer
  • 5. The suffix -ate means “to act on.” If the word values means “principles or standards we consider important,” what is the mean
    14·1 answer
  • What do we call the process of
    6·2 answers
  • Signal molecules are responsible for regulating the allocation of resources in the body in response of times of stress.
    11·1 answer
  • Blood vessel diameter fluctuates between being constricted and being dilated. This is the primary contributor to blood pressure.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!