1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mojhsa [17]
4 years ago
14

The formation of the Hawaiian Islands is one example of a. volcanoes forming over a hot spot. b. volcanoes forming along plate b

oundaries. c. the Ring of Fire. d. random occurrence of volcanoes. Please select the best answer from the choices provided A B C D
Biology
2 answers:
sashaice [31]4 years ago
5 0

Answer:

<h3><u><em>A. volcanoes forming over a hot spot.</em></u></h3>

Tanya [424]4 years ago
4 0

Answer:

I believe the answer would be B.

Explanation:

Volcanoes forming along plate boundaries. I believe this is the correct answer because volcanoes don't happen randomly, the ring of fire is a just a bunch of volcanoes formed along what i think is a plate. So in my opinion answer choice B makes the most sense. (Hope this helps ya! :D)

You might be interested in
A car travels 300 km in 6 hours. What's the average speed of the car? O 50 km/h O 65 km/h O 45 km/h O 75 km/h​
MAXImum [283]

Answer:

50 km/h

Explanation:

The average speed of the car is essentially the same thing as the unit rate.

Here a car goes 300 km for every 6 hours. To find the unit rate, we must find how many kilometers it goes per hour.
To do so, we can divide 300 by 6 to get a total of 50km/h.

6 0
3 years ago
An enzyme produced in the stomach that breaks down proteins - *
Alik [6]

Answer:pepsin

Explanation:

8 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
- Which of the following is least likely to lead to the formation of turbidity currents and submarine canyons?
goblinko [34]

Answer:

C

Explanation:

7 0
3 years ago
A glucose molecule is the______________ Choices: smallest type of protein. . monomer of starch and cellulose. . largest of the c
Readme [11.4K]
A glucose molecule is the monomer of starch and cellulose
4 0
3 years ago
Read 2 more answers
Other questions:
  • Terry is a 22-year-old woman who weighs 132 pounds. using the simple "rule of thumb" method, what is her estimated 24-hour basal
    9·1 answer
  • A body weight that is 10 to 15 percent below the desired weight is
    9·1 answer
  • Hypothesize what potential impact a mutated EGFR allele will have on a cell. Give one possible impact and explain your answer.
    14·1 answer
  • NEED HELP DUE TODAY PLZ HELP ME!!!!
    13·2 answers
  • The Earth's atmosphere is divided into five layers. In the middle layer is where most foreign objects, such as meteors, will bur
    7·2 answers
  • What is produced and traded for, including agricultural products and manufactured items?
    6·1 answer
  • Synonym of genotype and definition
    15·1 answer
  • What makes Protists different from the Bacteria kingdoms?
    11·2 answers
  • If you were going to use morphology, which of these animals would you think is most related to a hawk: a shark, a bat, or an all
    5·1 answer
  • When did anton van leeuwenhoek invent the microscope
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!