1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faltersainse [42]
3 years ago
7

Why is gravity considered a law and not a theory

Biology
1 answer:
mr_godi [17]3 years ago
7 0
It's a fundamental law of how the universe organized.
You might be interested in
6. What disease is caused by the ameba? First person ro get right answer gets mark as brainliest.​
NeX [460]

Answer: Amoebas of the Entamoeba group

Explanation:

Amoebiasis, also known amoebic dysentery, is an infection caused by any of the amoebae of the Entamoeba group. Symptoms are most common during infection by Entamoeba histolytica. Amoebiasis can be present with no, mild, or severe symptoms. Symptoms may include abdominal pain, diarrhea, or bloody diarrhea.

3 0
3 years ago
Read 2 more answers
It takes 1 minute for a certain amount of potassium bromide (KBr) to dissolve in 100 grams of water at 25 °C.
Mrrafil [7]
The sample will disolve in less than one minute.... temperature changes the rate of reactions...... 
3 0
4 years ago
Read 2 more answers
Which statement best explains how hereditary information is passed from parents to offspring
Maslowich

Answer:

.

Explanation:

8 0
2 years ago
How Do Different Liquids Affect Plant Growth?
Leona [35]
It all depends on what kind of liquid it is, if you were to use water, the plant would be fine, but if you were to give it, say, car gas, the plant would most likely die..... I hope this helped!
7 0
3 years ago
Please help me. <br> A<br> B<br> C<br> D
NNADVOKAT [17]

Answer:

it is d

Explanation:

5 0
4 years ago
Read 2 more answers
Other questions:
  • Which of these correctly explains differences between steroids and enzymes
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Why is understanding mitts important?( Select the best answer)
    6·1 answer
  • A. what role does mrna play in the flow of information in the cell? (hint: remember the central dogma of molecular biology.) ple
    10·1 answer
  • WILL GIVE BRAINLEST Radon is a kind of _____.
    9·2 answers
  • Can selective breeding be done with other animals? Why or why not?
    15·1 answer
  • Hi PLS HELPP: 15 points
    12·2 answers
  • Which of the following are considered disadvantages of an agricultural society?
    11·1 answer
  • What is the difference between a trait and a variation
    15·1 answer
  • Is algae multicellular or unicellular?<br><br> unicellular<br><br> multicellular
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!