1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Contact [7]
3 years ago
8

Which of the following best explains why the Inuit principally relied on hunting for survival? Group of answer choices A.Tundra

never thaws sufficiently for crops to grow. B.Prey animals are more scarce in tundra regions. C.The Inuit traditionally live near the coast. D.None of the above
Biology
1 answer:
Allushta [10]3 years ago
8 0

Answer:

Option (A)

Explanation:

The Inuits refers to those people that live in the Arctic region, such as Greenland, the northern region of Canada, as well as Alaska. The region in which they live can be considered as tundra, which is characterized by the presence of low temperature, dry wind, shorter duration of seasons, and lack of vegetation. This type of region is found in the polar and near-polar areas and in the high altitude areas.

The climate of tundra is very cold, and there occurs the layer of permafrost in the soil, and it does not provide the essential conditions for the growth of plants. The growth of crops is hindered by the shorter season, lack of sunlight and low precipitation.

This is why the Inuits are dependent on hunting for heir survival

Thus, the correct answer is option (A).

You might be interested in
Antigens are Multiple Choice something made by a white blood cell to destroy a pathogen. membrane receptors on B-lymphocytes. di
Zolol [24]

Answer:

Something that an antibody or T-lymphocyte binds to

Explanation:

As per the definition, antigens are the substances or molecules that are capable of inducing an immune response. When our immune system detects any unwanted substance or molecule in our body, the specific type of antibody is made against that antigenic substance and the antibody made against it binds to the antigen so that the other immune cells can recognize it and destroy it and protect us form its harmful effect. T-cell are also involved in recognizing antibodies and specific T-cell can bind to the antigen.

8 0
3 years ago
A scientist want to change the DNA of a sexually reproductive organism and have the new DNA represent in every cell of the new o
Dima020 [189]

Answer:

idk

Explanation:

3 0
3 years ago
Question 8
anastassius [24]

Answer:carbon dioxide

Explanation:

Cause animals release carbon dioxide for plants to inhale amd exhale oxygen

3 0
2 years ago
Read 2 more answers
Why do ecosystems that are part of the same biome tend to be similar?
inn [45]
Because the life is adapted to that biome.
6 0
3 years ago
What is the strong fibrous tissue outer periphery of the intervertebral disk called?
kvv77 [185]
<span>The answer is anulus fibrosus.

</span>
The intervertebral disk is located between vertebrae. It is has two parts, the middle part which is called nucleus polposus and the outer part, the <span>Anulus Fibrosus. This outer part, </span>is a strong fibrous tissue in the form of a ring, that can withstand compressive forces.
4 0
3 years ago
Other questions:
  • Which of the following would be considered quantitative observation
    9·1 answer
  • Solid waste in the ocean can threaten different marine species in many different ways. Many communities are working to reduce so
    7·1 answer
  • Which describes the correct order of the geologic time scale, from oldest to most recent?
    11·2 answers
  • At the end of the practical class, all tissue and the remaining carcass of the cane toad must be placed __________.
    5·1 answer
  • How do scientists know dark energy exists?
    6·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which statement best describes the result of meiosis?
    8·1 answer
  • How does farming creates job for people?
    10·2 answers
  • Why do plants need to obtain carbon atom
    14·2 answers
  • In this same forest ecosystem mentioned above, what are one possible reason the wolf population might decline?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!