1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
3 years ago
14

The yellow color on this MSA plate indicates the ability of this microorganism to ferment ​

Biology
1 answer:
Serga [27]3 years ago
6 0
If an organism can ferment mannitol, an acidic byproduct is formed that will cause the phenol red in the agar to turn yellow. Most pathogenic staphylococci, such as Staphylococcus aureus, will ferment mannitol.
You might be interested in
What is the function of the cell membrane?
Kamila [148]

Answer:

The plasma membrane, or the cell membrane, provides protection for a cell. It also provides a fixed environment inside the cell, and that membrane has several different functions. One is to transport nutrients into the cell and also to transport toxic substances out of the cell.

7 0
3 years ago
Where is the electron transport chain for cellular respiration located?
SIZIF [17.4K]
Well the energy is stored in NADH and FADH2 during the krebs cycle and convert it to chemical bond energy in the form of ATP. In Eukaryotas, this reaction takes place on the inner mitochondrial membrane.
3 0
4 years ago
Read 2 more answers
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
4 years ago
What is an important nursing action for the administration of colchicine to the patient in the acute care setting?
Tcecarenko [31]
Nurse should administer the medication with full glass of water at particular intervals throughout the day. this means that if the nurse is administering the capsules of 0.6mg he/she must administer its twice a day in the intervals of 12 hours because the recommended maximum dose for this drug is 1.2mg per day.   
3 0
3 years ago
What are the gametes that would be formed for the following genotype: Aa?
dlinn [17]

Answer:

A and a

Explanation:

GAMETE formation occurs via a process called MEIOSIS. During meiosis, segregation and independent assortment of genes occur. According to Gregor Mendel who proposed the law, the law of segregation states that the alleles of a Gene will separate into gametes. This separation occurs in such a way that only one allele of that gene is found in each gamete.

In this case, an organism with genotype "Aa" will produce gametes that contains the following: A and a. Therefore, the gametes of genotype Aa will be A and a.

5 0
3 years ago
Other questions:
  • What are two kinds of evidence used by modern taxonomists to classify organisms based on evolutionary relationship?
    7·1 answer
  • The kidneys are stimulated to produce renin ________. A. by a decrease in the blood pressure B. when the specific gravity of uri
    9·1 answer
  • Which part of an animal or plant cell contains the cell's genetic information?
    12·1 answer
  • How would i do this?
    9·1 answer
  • What are the similarities and differences between different types of maps?
    11·1 answer
  • Which type of mutation always creates a stop codon?<br> missense<br> nonsense<br> silent<br> point
    14·2 answers
  • Pls help! Thx!!! :D
    7·1 answer
  • Propose an explanation as to why beta cells would have a greater concentration of rough endoplasmic reticulum and ribosomes than
    8·2 answers
  • The structure into which the filtrate first passes
    7·2 answers
  • Energy comes in many forms: thermal, nuclear, chemical, mechanical, etc. Even though there are many forms of energy, all energy
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!