1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nalin [4]
3 years ago
11

The ocean contains vast amounts of salts and other minerals. For example, 1 cubic kilometer of ocean water contains about 5,000

kg of gold and 10,000 kg of silver. What can you conclude from this information?
Biology
1 answer:
valina [46]3 years ago
4 0

Answer:

The ocean is rich.

Explanation:

You might be interested in
Which property results from the crystal lattice structure of ionic compounds? A. low melting point B. good electrical conductivi
lions [1.4K]

Answer:

C.) crystalline solids

Explanation:

The solid materials may be crystalline or amorphous. The concept of crystal structure is related to the organization of atoms in a geometrical form. Crystalline structures are present in various materials, where atoms distributed within their structure form a network called the crystalline lattice. Therefore, crystalline structures have salts, metals and most minerals. Crystalline structures are formed by unit cells that are their basic unit, as they constitute the smallest set of associated atoms found in a crystalline structure.

The molecules of the crystalline structures can have two types of bonds, the directional ones, which include the covalent and dipole dipole and the non-directional ones where the metallic, ionic, van der Walls bonds. When formed by ionic compounds, these crystalline structures can result in crystalline solids.

5 0
3 years ago
At what point in Meiosis is a cell considered haploid?
Sergio [31]
Cells become haploid cells towards the end of meiosis ll
4 0
3 years ago
Explain why nonpoint source pollution is a greater threat and hazard than point source pollution
balu736 [363]
Non point source pollution is a greater threat than point source pollution because non point source pollution disrupts the water cycle. 

7 0
3 years ago
In pea plants, green color (G) is dominant to albino (g). If we cross two pea plants that are heterozygous for color, what would
Harman [31]

Explanation:

<em><u>risky </u></em><em><u>behavior </u></em><em><u>and </u></em><em><u>abuse </u></em>

6 0
2 years ago
Which property of igneous rocks does the rate of cooling influence the most
Paha777 [63]
The rate mainly effects the size of the crystals in the rock forming
5 0
3 years ago
Other questions:
  • The typical state of a neuron is the _____, but when electrical signals stimulate it to its threshold, the _____ is immediately
    7·1 answer
  • Plants maintain homeostasis by _____.
    5·2 answers
  • Please help me!! :((
    12·1 answer
  • HELP HELP HELP!! I NEED THESE QUSTIONS ANSWER!!! PLZ
    12·1 answer
  • What is the answer to the first problem I am really stressed and struggling bio is not my subject
    13·1 answer
  • How does the impact of the virus differe between lytic and lysogenic cycles?
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What does c h o n s stand for
    8·1 answer
  • Which statement is true,please anwser i put more points
    6·1 answer
  • During calcium chloride transformation of bacteria, during which step does plasmid DNA enter the bacterial cells?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!