1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mila [183]
3 years ago
12

Two is subtracted from a number the the difference is divided by 3. the result is 30

Mathematics
1 answer:
ollegr [7]3 years ago
3 0
30x3=90 90+2=92 The answer would be 92.
You might be interested in
Z is the midpoint of XY<br> XY = 27
Nimfa-mama [501]

X=13.5

Y=13.5

Therefore Z is 13.5

4 0
2 years ago
A soccer goal is 24 feet wide. Point A is 40 feet in front of the center of the goal. Point B is 40
Liono4ka [1.6K]

Answer:

a) Angles A and B are 90 degree.

b) The 2 angles are equal

c) From point A having a better chance to kicking the ball in to goal

Step-by-step explanation:

a, b) 2 points are in front of the center and right post of goal. Because there is no detail, we can assume that point A, point B, center of goal, right goal post make up a rectangle. Therefore, the 2 angles are measured equally as 90 degree.

c) Because it's a rectangle, the distance between point A and center of goal is shorter than that between point B and center of goal.

3 0
3 years ago
A phone company charges a flat rate of $15 to make phone calls for a month.they charge $0.10 per minute for each call made.if th
Ne4ueva [31]

Answer:

450 minutes

Step-by-step explanation:

15 + 0.1x = 60

15 - 15 + 0.1x = 60 - 15

0.1x = 45

\frac{0.1x}{0.1} = \frac{45}{0.1}

x = 450

5 0
3 years ago
Read 2 more answers
Word Problem
Sladkaya [172]

Step-by-step explanation:

1 l = 22.5 km

125 l = 22.5 × 125 = 2812.5 km

5 0
3 years ago
Which one is it? please help
Kamila [148]

Answer:

Indepentent

Step-by-step explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • What is the factored form of 6n4 – 24n3 + 18n?
    13·2 answers
  • mr. Bailey is the principal of the school with 465 students and 44 teachers. The librarian told Mr Bailey that there were 16 tim
    14·1 answer
  • Evaluate the expression. 2 • 15 – 7 + 4
    6·1 answer
  • 2(3x-5) equal or less than to 14
    9·1 answer
  • Which similarity postulate or theorem can be used to verify that the two triangles shown below are similar?​
    10·1 answer
  • When solving -1/3 (x − 15) = −4, what is the correct sequence of operations?
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • A screwdriver is 20 centimeters long, and a piece of wire is 10 millimeters long. The screwdriver is how many times as long as t
    14·2 answers
  • Find the 13th term in the following<br> arithmetic sequence :<br> 2, 10, 18, 26, ...
    9·1 answer
  • If x – 10 is a factor of x2 – 8x – 20, what is the other factor?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!