More rainfall leads to the growth of the grass in a tallgrass prairie to grow so tall.
Answer: Option B.
<u>Explanation:</u>
The tallgrass prairie consists of big and little blue stem, switchgrass, and Indian grass. These were the species which thrive in the area which receive rainfall in large amount. The rainfall in these areas are in the amount of 30-40 inch annual precipitation.
Because these areas receive rainfall in such high amount, the grasses grow very tall. The height of these grasses reach to approximately 6-8 feet in height.
Answer:
Biogeochemical cycle is one of the several natural cycles, in which conserved matter moves through biotic and abiotic parts of a ecosystem. In biology, conserved matter refers to the finite amount of matter, in the forms of atoms, that present within the earth.
Explanation: It is true that the chemical is one of the natural cycles within earth
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The correct options are, frying an egg and burning candle.
Explanation :
Physical change : It is a change in which no new compounds are formed only changes occurs in size or state of substance. In this, there is no changes in the substance or compound.
Chemical change : It is a change in which a new compounds are formed by the chemical reaction. Changes occurs in their chemical composition and properties.
Frying an egg : It is a chemical change because a new substance is form by heating.
Burning a candle : It is chemical change because new substances are formed (carbon dioxide, water and heat) by burning.
Boiling alcohol : It is physical change because only changes in the state.
Melting and ice : It is a physical change because only changes in the state.
Making coffee : It is a physical change because no new substance is formed.
Therefore, frying an egg and burning candle are the example of chemical change.
