The aerodynamic shape and lightness of the blue shark body allow it
to move “elegantly” across the oceans. It exhibits countershading like
many other sharks. The upper part is an indigo blue tone while the
ventral and the sides are white.
It has a long caudal heterocercal fin. The second dorsal fin measures
almost half the size of the first and its pectoral fins are unusually
long compared to other sharks. Its eyes are large, its teeth are
triangular, and it has a conical snout.
It reaches a length ranging from 3.8 to 4 meters and weighs about 240
kilograms. This species presents slight sexual dimorphism since the
female tends to measure little more than 1 meter in comparison with the
male.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Chlorophyll is found in the <span>chloroplasts :)</span>
Nuclear fusion takes place at the core of the sun
Answer:
Most genes contain the information needed to make functional molecules called proteins. (A few genes produce other molecules that help the cell assemble proteins.) The journey from gene to protein is complex and tightly controlled within each cell.
Explanation:
Most genes contain the information needed to make functional molecules called proteins. (A few genes produce other molecules that help the cell assemble proteins.) The journey from gene to protein is complex and tightly controlled within each cell.
