1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodka [1.7K]
3 years ago
5

The option that best describes viruses is: Viruses are nonliving infectious agents. Viruses cannot replicate on their own and th

ey need a host cell in order to survive. Antibiotics kill bacteria but not viruses. Antivirals and vaccines are made available to decrease the production of viruses, but not totally stopping them. Bacteria and virus differ in so many ways.
Biology
1 answer:
Umnica [9.8K]3 years ago
7 0
<span>I think the answer is: Viruses are nonliving infectious agents. </span>
You might be interested in
One effect of air pollution is destruction of
vampirchik [111]
The ozone layer is the answer!
5 0
2 years ago
How do the small molecules of oxygen and carbon dioxide move through the cell membrane?
iris [78.8K]

Answer:

A.  passive transport by diffusion

Explanation:

Diffusion and osmosis are both types of passive transport. They do not require energy. Diffusion is the general term for the process. Osmosis is the diffusion of water molecules.

Many small, uncharged molecules can cross the cell membrane by diffusion. Oxygen and carbon dioxide are examples of two small molecules that pass the cell membrane by passive transport.

Larger or charged molecules require energy to cross the cell membrane. This is achieved by active transport.

6 0
3 years ago
Question 1 (2 points)
solniwko [45]

Answer:

DNA

Explanation:

RNA is not a double helix

Uracil is on the RNA, this is a picture or DNA. Uracil is just one of the nucleic bases

This is not a monomer; it's actually a polymer

It is DNA because it is a double helix structure held together by the four nucleic bases.

7 0
3 years ago
Pls help view the attached
MariettaO [177]
I think c i explained it
8 0
2 years ago
1) Stage 1: What is a property of gas?
Kazeer [188]

Answer:

1.a

2.c

3.a

4.c (that's the closest)

5.d

6 0
3 years ago
Other questions:
  • How does the density of warm water and cold water compare
    14·2 answers
  • What is the function of the organelles that are labeled F?
    12·2 answers
  • Which of the following statements about weather along mountain ranges is correct?
    7·1 answer
  • The _______ is responsible for forming the outer, limiting barrier of a cell.
    10·1 answer
  • The Rainforest Alliance is a program sponsored by several governments of countries with rainforests. Please select the best answ
    13·2 answers
  • Choose all the answers that apply.
    11·1 answer
  • The geographic isolation of a population from other members of the species and the subsequent evolution of reproductive barriers
    10·1 answer
  • If enzymes are proteins then what monomers do they form when they denature?
    9·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which statement describes a process associated with meiosis?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!