1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GarryVolchara [31]
3 years ago
6

Do plants make food in their stems flowers roots or leaves?

Biology
2 answers:
ryzh [129]3 years ago
5 0

hello!

its in leaves

have agoed day

Ipatiy [6.2K]3 years ago
5 0

Plants are able to make their own food in their leaves.

They mostly do it in their leaves because that is where the chloroplast is and it holds chlorophyll which causes photosynthesis (the process of making food for a plant.)


hopefully my answer helps! ♡

(if my answers helped you please tell me, therefore I know.. that I did them correctly or incorrectly. anyways, have a great day/night!)

You might be interested in
Indicate the relationship between the two items listed in each situation: (can be used more than once or not at all) - A. Restin
weqwewe [10]

With regard to Neural Permeability, the relationships between the two items listed in each care is as follows:

  • A. Resting neuron's permeability to K⁺
  • B. Resting neuron's permeability to Na⁺ (Option C)

  • A. Neuron's permeability to Na⁺ during the rising phase of an action potential
  • B. Neuron's permeability to K⁺ during the rising phase of an action potential (Option F)

  • A. Resting neuron's permeability to Na⁺
  • B. Neuron's permeability to Na⁺ during the rising phase of an action potential (Option B)

  • A. Resting neuron's permeability to K⁺
  • B. Neuron's permeability to K⁺ during the falling phase of an action potential (Option A)

  • A. Neuron's permeability to Na⁺  during the falling phase of an action potential
  • B. Neuron's permeability to K⁺  during the falling phase of an action potential (Option D)

It is to be noted that the grading is as follows:


A) is for when B is greater than A

B) is for when B is greater than A

C) is for when A is greater than B

D) is for when B is greater than A

E)  is for when A and B are equal

F) A is greater than B

<h3>What is Neural permeability?</h3>

This (in simple terms) refers to the degree to with neurons allow the transmission of solutes and solvents in and out of them.

Learn more about neural permeability at;
brainly.com/question/14301289
#SPJ6

6 0
2 years ago
What best describes a theory
Naya [18.7K]
A thought that can and/or has been tested multiple times to prove it's true or false. And is used by others if prove true.
7 0
3 years ago
What are examples of controlled processes in psychology?
kodGreya [7K]
Automatic Processes<span> are </span>processes<span> that utilize few mental resources, and several of these may take place at the same time. Both types of </span>processing<span> take cognitive resources. ... An </span>example<span> of a </span>controlled process<span>, as mentioned in the introduction, is driving a car.</span>
8 0
3 years ago
WHOEVER GETS IT RIGHT, GETS BRAINLIEST!!!!!!!! Please see if this answer is correct!
aleksandrvk [35]

Answer:

yes your answer is correct

Explanation:

this is because the cells that fight against foreign materials are found in the blood

4 0
2 years ago
10.<br> _________produces pollens and______<br> develops into the fruit.
vichka [17]

Answer:

stamen produces pollen ovules develops into fruit

Explanation:

8 0
3 years ago
Other questions:
  • Which feature is an example of physiological adaptation? beak sizes of birds octopuses’ ability to squirt ink communicating in s
    12·2 answers
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Read the two statements given below. Statement 1: Children knocked over the trash can while cycling Statement 2: Plant cells gen
    11·2 answers
  • Two phenotypically tall heterozygous pea plants are crossed to one another. A phenotypically tall F1 progeny plant is randomly c
    7·1 answer
  • Which occurs as part of gas exchange?
    6·2 answers
  • Marilyn has had a lump removed from her breast and sent off to a pathologist for examination. what description of the tumor woul
    10·1 answer
  • (06.03 LC) Which of the following is an example of how HIV can be transmitted from one person to another? Contact between infect
    10·1 answer
  • Which constellation has two stars that point to Polaris the North Star
    12·2 answers
  • Question One
    7·2 answers
  • On a sunny day at an open market a vendor, Ms. Milly, occasionally sprinkles water on her wilting lettuce. During the day Ms. Mi
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!