1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vekshin1
3 years ago
10

Because the final stages of cellular respiration require oxygen the are said to be

Biology
1 answer:
Leni [432]3 years ago
7 0
The word that describes a process that can only happen in the presence of Oxygen (such as the final stage of respiration, the <em />Electron Transport Chain) is Aerobic.

Conversely, if a process does not require the presence of Oxygen (such as glycolysis, the first stage of respiration) we can say that it is anaerobic.

You might be interested in
What is the purpose of the motor neuron?
Mariulka [41]

Answer:

ans this question is no 3

Explanation:

Because it sends electrical output signals to the muscles affecting the muscles ability to functions.

7 0
3 years ago
Read 2 more answers
AM I CORRECT??
Lerok [7]
Yes A is the correct answer
5 0
3 years ago
Read 2 more answers
Why do most leaves tend to appear green if they reflect green light?
Alex73 [517]
Because our eyes see what's reflected not absorbed. Leaves contain chlorophyll which contains a pigment of green that absorbs red and blue wavelengths, while reflecting green.
4 0
2 years ago
Read 2 more answers
During which phase of mitosis does the nuclear envelope beak up?
larisa [96]
In prophase of mitosis the nuclear envelope breaks up
8 0
3 years ago
Describe how the release of the neurotransmitter, dopamine, can result in addiction to tobacco products.
DaniilM [7]
Dopamine is a chemical released by neurons to send signals to other nerve cells. the brain includes several distinct dopamine pathways, one of which plays a major role in reward motivated behavior.
smoking is a habit, in a habit there is the cue, routine, and reward. with smoking the cue can be different things, most commonly stress or anxiety. the routine how you react to those cues, the reward is the chemical 'triggers' that are pulled inside you're brain leaving you feeling calm, happy, or relieved, etc.
3 0
3 years ago
Other questions:
  • We can use the periodic table to determine which atoms are most likely to lose or gain electrons during the formation of an ioni
    8·2 answers
  • Which of the following cells would not have a well–defined nucleus but would have a thick cell wall and ribosomes?
    11·1 answer
  • PLEASE HURRY!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    7·1 answer
  • Natural selection can affect the diversity of organisms within a population. This can sometimes be seen through the distribution
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • For children with two myopic parents, the likelihood of becoming myopia is _____ correlated with the number of hours spent playi
    12·1 answer
  • The change in mhr is the same from ages 20 to 26 as it is from ages 40 to 46
    7·1 answer
  • Crushing a can in your hand is an example of ____.?
    14·1 answer
  • Ball and socket joint definition
    13·1 answer
  • Please answer the following statement:
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!