1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
geniusboy [140]
3 years ago
7

1. List five things you use daily whose production is a direct result of microbial action. In addition to the product include wh

at produces the products (bacteria. mold etc). and the brand names of the products. (This is a list and does not require grammatically correct sentences.)
Biology
1 answer:
juin [17]3 years ago
7 0

Answer:

Various day to day use item are made because of direct from a huge amount of different microorganisms. microscopic organisms, molds, or a blend of these. Microorganism which are utilized in food creation such as alcohols, bakery products and esters are formed with fermentation.

1. Drinks like brew and wine ' - Saccharomyces cerevisiae

2. Cheese: Penicillium roqueforti and camemberti  

3. Soy sauce: by utilizing aspergillus species particularly A. oryzae

4 Bread and pastry shop items : Saccharomyces cerevisiae  or Yeast by producing Co2 by the process of fermentation.

5. Fermented milk items : Lactobacillus, Bifidobacterium and lactococcus.

You might be interested in
Which of the following is not a contributing factor to environmental policy decisions? a. human health b. availability of natura
tamaranim1 [39]

None of the above is not a contributing factor to environmental policy decisions and is denoted as option D.

<h3>What is Environmental policy?</h3>

These are actions by the government in the protection of the environment and conservation of resources.

The contributing factor to this includes the following:

  • Human health
  • Availability of natural resources
  • Environmental health.

Read more about Environmental policy here brainly.com/question/3316812

#SPJ4

8 0
2 years ago
What are the two cells that pick up light and color in the back of your eye
Luden [163]

Answer:

The retina is the back part of the eye that contains the cells that respond to light. These specialized cells are called photoreceptors. There are 2 types of photoreceptors in the retina: rods and cones.

Explanation:

4 0
4 years ago
Read 2 more answers
A water bottle is sitting in front of a poster. The letters seen through the water bottle appear larger. Explain why this is tru
dmitriy555 [2]

Answer: Light Refraction

Explanation:

Light rays travel in straight lines. When they strike an opaque surface, the rays bounce, and light is reflected back to your eye so that you see an image. When light strikes a transparent object, some of the light passes through. If that light strikes the object straight on, it continues to travel in a straight line. If the light enters the transparent object at an angle, though, it changes direction, bending.This bending of light is called refraction. Refraction occurs because light entering an object slows down. When it enters at an angle, one side of the light ray enters before the other, slowing down first.Looking from above, an object under water appears larger than it does in air. It's not that the image the light gave our eyes is bigger. It's that the image is actually closer to our eyes, since the light is not passing straight down, but is instead bending relative to the water's surface. Light passing straight down would be perpendicular to the water's surface, like the vertical line on the letter T.

5 0
3 years ago
What observable characteristic could be used to identify this rock sample as gneiss
svp [43]
Can you put a pic of the rock for me
5 0
3 years ago
HHHEEELLLPPP!!!
malfutka [58]

Answer:

D

Explanation:

Lava at Earth's surface flows over rocks.

3 0
3 years ago
Other questions:
  • There are two main ways in which molecules are transported into and out of cells - active transport and passive transport. Which
    14·2 answers
  • A plant pigment that absorbs sunlight is called
    11·1 answer
  • Explain two reasons why we can conclude that the rise of the water in the glass tube is due to root pressure and not transpirati
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • WILL MARK BRAINLIEST!!!!! thank you!
    15·1 answer
  • When jimmy had shingles the virus spread throughout an entire area served by one spinal nerve. This area was called a(n):?
    13·1 answer
  • What is Bombay blood group???<br>how it differs from O blood group??​
    9·1 answer
  • The specific heat of a substance is a measure of how much energy is required to raise
    6·1 answer
  • What determines the order of an mRNA sequence?
    5·1 answer
  • Is 11/12 greater then 2/3 explain
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!