1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enyata [817]
3 years ago
12

Idetify the animal below that is not in the same coass as others

Biology
1 answer:
AfilCa [17]3 years ago
4 0
Where is the picture?
You might be interested in
Aristotle first proposed that _____ was at the center of the solar system.
disa [49]
C the earth because that is the only planet around so he thought that the sun and everything else rotated around us.
4 0
3 years ago
Read 2 more answers
Which water soluble vitamins are absorbed in the small intestines quizlet?
Bas_tet [7]

The B vitamins and vitamin C are absorbed along with water in the small intestine and then circulate through the blood.

5 0
2 years ago
SOMEONE HELP ME PLEASE
nignag [31]

A. agriculture

HOPE THIS WILL HELP U

7 0
3 years ago
Read 2 more answers
The rate of O2 production by the light reactions varies with the intensity of light because light is required as the energy sour
kupik [55]

Answer:

The correct answer is option a.

Explanation:

Yes, the light reactions also depend upon the Calvin cycle. Calvin cycle refers to a phenomenon that is used by the plants and algae to convert carbon dioxide from the atmosphere into sugar, the food needed by the autotrophs in order to grow. The plants rely upon the Calvin cycle for food and energy.  

In the given case, the rate of oxygen production would get diminish as the rate of ATP and NADP+ generated by the Calvin cycle diminishes. Of all the outcomes of the Calvin cycle, ADP and NADP+ are the only ones that get utilized by light reactions.  

The ADP and NADP+ are used up by the light reactions to fuel their reactions. This illustrates that if the rate of ADP and NADP+ generated by the Calvin cycle diminishes the production of oxygen by the light reactions also diminishes.  

5 0
3 years ago
How does asexual reproduction allow for genetic continuity
GalinKa [24]
There is no variety in asexual reproduction 
5 0
4 years ago
Other questions:
  • Gina's father has diabetes and takes insulin. He recently had a liver transplant, after which he was put on anti-rejection medic
    12·1 answer
  • I'm confused can someone help me out?
    6·2 answers
  • What event marked the end of the mesozoic era and the beginning of the cenozoic era
    15·1 answer
  • I was finishing Summer B Plato Biology for High School when the program closed. All I had left to finish was my final. Does anyo
    7·1 answer
  • What is special about the Earth that gives us the four Seasons
    15·1 answer
  • How are cast formed?
    11·2 answers
  • Will turtles become extinct
    5·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What enables liquid water to take the shape of its container?
    15·1 answer
  • 1. A group of individuals of the same species that mate and produce offspring is called a
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!