1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bagirrra123 [75]
2 years ago
14

Which of the following structures help the cell remove wastes:

Biology
2 answers:
drek231 [11]2 years ago
4 0

Answer:

Vesicles help the cell remove wastes

Leni [432]2 years ago
3 0

Answer:

Lysosomes break down waste products within the cell and transport the remains out of the cell. They contain enzymes that help them do this.

Explanation:

i hope you understand

You might be interested in
c-Met is an oncogene that contributes to the development of certain cancers by triggering cell division and tumor growth. In a 2
lisabon 2012 [21]

Answer:

G1 phase cell cycle arrest and apoptosis

Explanation:

According to Yan and colleagues 2009 article, cells that were transfected with microRNA-1/206 showed cell cycle arrest at the G1 phase and showed an increase in apoptosis (programmed cell death) which is important for synthesis of mRNA and protein. These processes have a direct effect on cell proliferation by decreasing it.

3 0
2 years ago
Type the correct answer in the box.
Oduvanchick [21]

Answer:

2,000

Explanation:

4 kilograms will go in the tank in 1 second. So for 8,000 kilograms of water you divide 8,000 by 4. Which gives you 2,000. Got it right on Plato as well.

3 0
3 years ago
Read 2 more answers
What characteristics do living things have that differentiate them from non-living things?​
Gelneren [198K]

non living things do not respirate

7 0
2 years ago
Read 2 more answers
What the word is art
nadya68 [22]
The expression or application of human creative skill and imagination, typically in a visual form such as painting or sculpture, producing works to be appreciated primarily for their beauty or emotional power.
5 0
3 years ago
Read 2 more answers
Gene mutations that result in cancer often cause the
Anarel [89]
Gene mutations that result in cancer often cause the cells to divide uncontrollably. When too many cells are made to quickly it develops into a tumor which usually leads to cancer.<span />
4 0
3 years ago
Other questions:
  • How does capillarity help sustain life? a. Plants use capillarity to move water from their roots to their leaves. b. Capillarity
    6·1 answer
  • Which type of mutation results in a base pair within a DNA sequence being replaced with a different pair?
    5·2 answers
  • Which statement best describes how a major change in size of one population affects an ecosystem
    7·2 answers
  • What are the types of erosion
    12·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Weeds growing in a vegetable garden and requiring the same nutrient at the vegetables is an example of?
    6·2 answers
  • Which organisms move from place to place through the interaction of muscles and jointed appendages?
    9·2 answers
  • How can I identify an organelle? Please help I have till 11:59 to answer this question.
    9·1 answer
  • "Cellular respiration takes the energy stored in glucose and transfers it to ATP." Other word(s) for transfers:
    15·1 answer
  • Do most people want to have a low infant mortality rate or high infant mortality rate?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!