Answer:
See the answer below
Explanation:
First, the image tells that chromosomes are made up of genes or that genes are located on chromosomes. It further showed that genes are translated as proteins in the cell and this protein respectively control the expression of traits.
Secondly, it also showed that during sexual reproduction, the offspring produced usually have the same proteins as the parent and therefore have exactly the same traits as the parent. Only one parent is needed for asexual reproduction.
<u>However, two parents are needed for sexual reproduction where each parent donate chromosomes containing gene to the genome of their offpsring. The mixture of genes ensures that the offspring look different from the parent.</u>
<em>The image further showed that asexual reproduction does not lead to any variation while sexual reproduction leads to variation of the offpsring from their parents.</em>
The main dietary factor associated with elevated blood cholesterol is saturated fat.
<h3>
What about saturated fat?</h3>
- Because they increase the amount of LDL cholesterol in our blood, saturated fats, sometimes known as "bad fats," increase the risk of cardiovascular disorders (including heart disease and stroke).
- Cholesterol that is circulated in the blood.
- The majority of this cholesterol is produced by the body, however some is also absorbed from the meals you eat.
- Even if they include fat, foods derived from plants never contain cholesterol.
- Only foods from animals do. Low density lipoproteins are able to transport cholesterol.
- Dietary fat, particularly saturated and trans fats, may increase LDL and total cholesterol levels in the blood.
- Blood cholesterol levels may be lowered by substituting polyunsaturated and monounsaturated fats, particularly olive and canola oil, for some saturated fats.
- When we consume too much saturated fat, the receptors stop functioning as effectively, and blood cholesterol levels rise.
Learn more about saturated fat here:
brainly.com/question/21816695
#SPJ1
Fossils could not be found in that layer of rock
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
The correct answer is 3: "<em>High levels of Ca2+ are expected to be found </em><em>within the sarcoplasmic reticulum</em>".
Explanation:
Muscular contraction is a highly regulated process that depends on free calcium concentration in the cytoplasm. Amounts of cytoplasmic calcium are regulated by <u>sarcoplasmic reticulum</u> that functions as a storage of the ion.
When a nerve impulse reaches the membrane of a muscle fiber, through acetylcholine release, the membrane depolarizes producing the entrance of calcium from <u>extracellular space</u>. The impulse is transmitted along the membrane to the sarcoplasmic reticulum, from where calcium is released. At this point, <em>tropomyosin is obstructing binding sites for myosin on the thin filament</em>. The calcium channel in the sarcoplasmic reticulum controls the ion release, that activates and regulates muscle contraction, by increasing its cytoplasmic levels. When <em>calcium binds to the troponin C</em>, <em>the troponin T alters the tropomyosin by moving it and then unblocks the binding sites,</em> making possible the formation of <em>cross-bridges between actin and myosin filaments.</em> When myosin binds to the uncovered actin-binding sites, ATP is transformed into ADP and inorganic phosphate.
Z-bands are then pulled toward each other, thus shortening the sarcomere and the I-band, and producing muscle fiber contraction.
