1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
5

What is the shape of a nerve cell and how does its shape match its functions?

Biology
1 answer:
Gala2k [10]3 years ago
4 0
A nerve cell is a cell that travels in a nerve bacilcly it is neuron and it transmits signals to the brain to do something so if we want the wave our hand the nerve cell/neuron transmits signals to the brain.
You might be interested in
Define the word homology ?
Aleksandr [31]

the state of having the same or similar relation, relative position, or structure
4 0
4 years ago
which of the following statements best describes the relationship between sex chromosomes an autosomes in humans?
kiruha [24]
Sex chromosomes and autosomes make up the chromosomes. Sex chromosomes determine the sex of the organisms while autosomes determine the physical characteristics of the organisms. Although the sex chromosomes only determine the sex of the organism, it has a direct link to certain physical characteristics of an organism i.e., colorblindedness is only common to males.
5 0
4 years ago
How does the paradise flycatcher protect its young from predators?
Ksivusya [100]

Answer:

c). It builds a camouflaged nest.

Explanation:

It uses coarse matter like branches and bark for the net framework then lined and camouflaged with soft grass, leaves and other material, finally held them together by spider web.

5 0
3 years ago
Read 2 more answers
20 POINTS!
Flauer [41]

Answer:

fals tru true

Explanation:

3 0
3 years ago
Read 2 more answers
What species of homo found in java suggest that this species of hominine spread rapidly after leaving Africa
Oxana [17]
Species of homo erectus 
6 0
3 years ago
Other questions:
  • Chromium is an essential mineral that participates in carbohydrate and lipid metabolism.
    13·1 answer
  • Why would a huge snowstorm have anything to do with global warming?
    15·1 answer
  • Do you think aliens are real?
    11·2 answers
  • Read "What Emissions and Byproducts Are Produced from Burning Coal?" Why is the presence of mercury in water of great concern to
    13·1 answer
  • To visualize the structure of DNA, which has a width of 10 nm, which microscope would be best
    6·1 answer
  • What is a community?
    15·1 answer
  • Although a liver cell and a muscle cell in a human developed from the same single cell, their appearance and functions are diffe
    12·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • The ________ returns blood from the body regions below the diaphragm.
    10·1 answer
  • 2Generaris aison costo ¿ Por que? ​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!