1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stellarik [79]
3 years ago
7

Which statements explain the gas exchange that happens at the alveoli? Check all that apply.

Biology
1 answer:
Arturiano [62]3 years ago
8 0

Answer: B, C, E

Explanation:

We breathe in oxygen, which travels to the alveoli in our lungs. The alveoli "gives" oxygen to the capillaries, which carry blood. The capillaries "give" its carbon dioxide (which is what oxygen becomes when used by our body) to the alveoli. The carbon dioxide travel back out when we exhale. Although, the air we breathe out has some oxygen content.

You might be interested in
A flattened membrane sac inside the chloroplast used to convert light energy into chemical energy
algol [13]

Answer: D: Thylakoids

Explanation:

Thylakoids - A flattened, membranous sac inside a chloroplast. They often exist in stacks called grana that are interconnected; their membranes contain molecular "machinery" used to convert light energy to chemical energy.

***If you found my answer helpful, please give me the brainliest, please give a nice rating, and the thanks ( heart icon :) ***

6 0
3 years ago
If sunlight begins to warm a frozen lake, the atoms in the lake’s frozen water will begin to move faster. True False
Masteriza [31]
This statement is true, because the warmer the temperature, the faster the atoms move in a liquid
4 0
3 years ago
Read 2 more answers
plzzz help i will give brainlyest Sally says that divergent plates cause the greatest, strongest Earthquakes. Marks says she's w
KatRina [158]

Answer:

Mark

Explanation:

At divergent plate boundaries, earthquakes tend to be weak and shallow. Transform plate boundaries, have shallow, but very powerful earthquakes. At convergent plate boundaries, where two continental plates collide, earthquakes are deep and also very powerful.

4 0
2 years ago
Read 2 more answers
Scientists are observing lions hunting on the savanna. They notice that when the temperature of the air increases the lions are
borishaifa [10]

Answer: If the temperature increases, then the activity of the lions decreases.

7 0
3 years ago
Which of the following is not a part of environmental science? a. interactions of organisms and the environment b. human impact
KatRina [158]
I believe it d<span>. the components of a cell that's not dealing with the environment

</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Nucleic acids and carbohydrates are both types of what?
    9·2 answers
  • Which of the following statements about the ‘Hobbits’ of Flores is FALSE?
    13·1 answer
  • 30.Of the following, which component of life is the largest?
    5·1 answer
  • How are stem cells currently being used in the laboratory?
    7·2 answers
  • What kind of snake has got cylinder body and orange eyes?
    8·1 answer
  • We presume that meiosis evolved later than mitosis. What process would not have to evolve in cells undergoing meiosis in order t
    12·1 answer
  • Which of the measurements would be the most helpful in determining the wavelength?
    14·1 answer
  • What are two kinds of chemical properties of matter?
    7·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What’s the color of the grass
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!