1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flura [38]
2 years ago
5

Where trenches do not exist, the steep continental slope merges into a more gradual incline known as the continental ____. a aby

ss b zone c rift d rise
Biology
1 answer:
AlladinOne [14]2 years ago
6 0
Hey there mate!

This would actually be known as a <span>continental rise. If the trenches were to be (existed), then most likely </span><span>steep continental slope merges into a more gradual incline known as the continental would rift. 

It's practically the opposite of each other, which is pretty neat in this way.

</span><span>Where trenches do not exist, the steep continental slope merges into a more gradual incline known as the continental rise.

Your correct answer would be (option D).

I hope this helps you!</span>
You might be interested in
Trap and keep warm air next to birds bodies
abruzzese [7]
Im pretty sure it is their feathers not for sure, but i think thats right
6 0
3 years ago
The world's largest ocean is the
Ksju [112]

\huge\purple{Hi!}

the answer is d.pacific ocean is the largest ocean in the world it is also the world's deepest ocean.

5 0
2 years ago
What do you think might affect the rate at which enzyme catalyze reaction in your body? Why?
Verdich [7]
Drastic change in pH or temperature because the enzyme reaction may become denatured.
3 0
3 years ago
Will mark brainliest
Leya [2.2K]

I think its D because it requires more force to push something over a greater distance...but i could be wrong...

Hope this helps! Please correct me if I'm wrong :)

4 0
2 years ago
How does an animals level fitness relate to its chance of survival and reproduction
maks197457 [2]
I'm not entirely sure what you mean, but a fit animal is one that is able to out-compete with other animals in its ecosystem. It possesses some kind of advantage, which makes it easier to compete with others for food, water, shelter, and mates. Due to these qualities, the animal is obviously able to live for a good deal of time and have a greater chance of producing viable offspring. 
7 0
3 years ago
Other questions:
  • When magma reaches the Earths surface its called?
    12·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of these do all prokaryotes and eukaryotes share?
    6·1 answer
  • The N-H bond in ammonia is polar because
    14·2 answers
  • Does osmosis cause things to grow?
    9·1 answer
  • Which activity is NOT part of the hydrosphere?
    6·2 answers
  • Assume that S. typhi immediately enters the bloodstream from the small intestine. Of the following, which would be the first maj
    12·1 answer
  • In photosynthesis, what form of energy is sunlight converted to, and how is this<br> energy stored?
    12·1 answer
  • Relate Cause and Effect
    12·1 answer
  • From a trough to a peak, the economy goes through
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!