1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LenaWriter [7]
3 years ago
15

Explain why predators and prey with many generations of interactions are likely to have pronounced behavioral responses to each

other.
Biology
1 answer:
kkurt [141]3 years ago
8 0

Answer:

Due to coevolution

Explanation:

Coevolution occurs when the evolution of two species (or more) is influenced by the biological relationships between those species. It is, the evolution takes place in a mutually dependent manner. A type of coevolution, is that of the type Predator-Prey , in which a selective pressure on the prey generates new features to avoid being captured, but at the same time, the predator evolves to overcome the new features adopted by the prey becoming a more effective hunter.  Thus, coevolution often leads to an evolutionary arms race between prey and predator

You might be interested in
What are three main ways in Which organisms interact
Mumz [18]

Mutualism, commensalism and parasitism

3 0
2 years ago
Is my answer correct?
Andre45 [30]

Answer:

Yes, I think you're correct!

Explanation:

7 0
2 years ago
Read 2 more answers
What do hypotheses theories and laws have in common
Umnica [9.8K]

Answer:

A theory is a group of hypotheses that prove a law is true.

Explanation:

A theory is an idea based on principles. A hypothesis is an explanation with limited evidence.  Laws are the system of rules indicated for each country.

4 0
2 years ago
Describe what corn, dogs, and genes have in common
dangina [55]
Artificial Selection or “ Selective Breeding”. aka the process by which humans use animal breeding and plant breeding to selectively
6 0
2 years ago
Examine the diagram below
Keith_Richards [23]

Answer:

A. the frequency will decrease because all mutations are harmful, thus People with the mutation will die.

5 0
3 years ago
Read 2 more answers
Other questions:
  • What are the four most common occurimg chemical elements in organisms​
    5·1 answer
  • Which kind of compound increases the hydrogen ion concentration in a solution?
    6·1 answer
  • BRAINLIESTTTTTTTTTTT!
    7·1 answer
  • The (blank) is the name for hollow muscular organ that stores urine.
    6·1 answer
  • Which organism can most likely be classified in the domain bactacteria
    15·1 answer
  • Question 6 Pls answer its 20 point
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • The division of the cytoplasm is called?
    8·1 answer
  • Photosynthesis and cellular respiration both involve the use and release of gases. Which statement correctly identifies the role
    13·1 answer
  • Feelings of hunger can be stimulated by the hormone _________, but suppressed by the hormone _________. A. insulin; glucagon B.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!