1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelechka [254]
3 years ago
6

A middle age star that burns hydrogen is a?

Biology
2 answers:
OlgaM077 [116]3 years ago
8 0

Could be the sun but that's just me

Sati [7]3 years ago
8 0

Answer:

<em>The main sequence star is the correct answer. Hope this helps!</em>

You might be interested in
Which traits should the student put in section i (inherited)? wolf's social status and blood type skin color and a scar tiger's
astra-53 [7]

The query is based in inherited and acquired traits wherein a student is provided with a list of traits and is asked to arrange them in a Venn diagram. The correct answer for the given query would be the third option. The traits that the student should put in the section inherited is tiger's stripes and type of blood.

5 0
3 years ago
Read 2 more answers
Humans ferment (blank) in muscles where oxygen becomes depleted
maksim [4K]
Humans ferment lactic acid in muscles where oxygen becomes depleted, which is why sometimes if you finish a run and don't stretch soon you have have discomfort. <span />
3 0
2 years ago
Read 2 more answers
Can someone helppppppppppppppppppppppp
zzz [600]

Answer:

Lymphatic: bacteria invade the body but are removed with the help of cells

Endocrine: A chemical message is signaled to help the body relax and sleep

Nervous: The brain signals for the muscles to contract

Explanation:

Lymphatic system is the part in the body that uses the cells in your body to help it.

The endocrine system is about hormones and how the body needs to maintain stable and have homeostasis.

The brain is part of the nervous system and it sends signals to other parts of the body.

5 0
2 years ago
Read 2 more answers
Help science cell is this correct????
Radda [10]

Answer:

yes

Explanation:

you are very right

7 0
3 years ago
Read 2 more answers
Which of these products is formed during the metabolic reactions of cellular respiration
earnstyle [38]
The correct answer is D.
3 0
3 years ago
Read 2 more answers
Other questions:
  • What is a nuclear transfer used for?
    6·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • MHC class II will interact with a TCR and
    11·1 answer
  • Compare and contrast the rock cycle and the carbon cycle
    15·1 answer
  • Which statement about the inner planets' orbits is true?
    15·1 answer
  • Can you please answer the three questions i will mark u brainlest asap less than 12 minutes. If you dont know don’t answer
    12·1 answer
  • Why does limestone react to acid rain, but sandstone does not?
    8·1 answer
  • Which type of stress is shown in the image?
    9·2 answers
  • Una persona tiene abuelos paternos albinos y su madre tenia pigmentacion normal en la piel (homocigotica). Como seran los genoti
    10·1 answer
  • Suppose you measure the diameter of the low-power field of view with a ruler and it is 2 mm. If high power provides 10X more mag
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!