1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lostsunrise [7]
3 years ago
13

A pure-breeding fruit fly with curled wings mates with a pure-breeding fruit fly with normal (straight) wings. The F1 mate with

each other to produce an F2 generation that consists of 160 flies with curled wings and 80 with straight wings. What can you infer from this observation?
Biology
1 answer:
vesna_86 [32]3 years ago
6 0

Answer:

The dominant curled wing allele is also a recessive lethal.

Explanation:

If we look at the F2 ratio we see that :  

curled wings: straight wings= 160:80

                                               =2:1

Hence,  if curled wings is considered to be a dominant trait then Curled wings * straight wings

Dd x dd

Punnet square will be as follows :

           d                    d

D   |    Dd   |        Dd

d    |    Dd   |        dd

Hence in order to get F2

Dd x dd

Punnet square will be the same as above if the F1 cross is Dd* Dd

        D    d

D DD Dd

d Dd dd

if DD is lethal then the ratio is

Dd:dd=2:1

that is curled wings: straight wings=2:1

Hence, The dominant curled wing allele is also a recessive lethal.

You might be interested in
Link between the struction and function of water molecule​
Inessa [10]
W a t e r ahhhh 8228c+x Skansen 2828
7 0
2 years ago
What is a cell? How are they different from atoms?
Lapatulllka [165]

Explanation:

Cells are the basic building blocks of all living things. The human body is composed of trillions of cells.

cells are bigger than atoms. We can see cells with a microscope. Just as atoms have smaller parts called protons, neutrons, and electrons, cells have smaller parts, too. When you look at cells with a powerful microscope, you can clearly see hundreds of them.

4 0
3 years ago
identify the part of the female reproductive system by lebeling the diagram.
trapecia [35]

Answer:

the first at the top is a fundus the one down to its right is the faloppian tube and on the other side pointing to the white is an ovary the one under ovarys is the myometrium then the last is the vagina

Explanation:

5 0
2 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
the eastern kingbird hunts by catching flying insects in mid-air, an approach which requires impressive and energetic acrobatic
tangare [24]

It is safe to assume that the eastern kingbird will have a <u>type 2 </u><u>functional response </u><u>to an increase in </u><u>prey abundance</u><u>.</u>

The functional response, in ecology, is a data-based description of the behavior of certain animals' consumption rates in response to a change in prey density. This can be of three kinds:

  • Type 1: An increase in consumption
  • Type 2: A decrease in consumption
  • Type 3:  Decreased consumption, followed by a quick increase.

The Eastern kingbird is likely to follow a <u>type 1 </u><u>functional response</u> to the presence of more prey. The reason for this, aside from it being the most common response, is that the eastern kingbird consumes insects, which do not provide a great amount of energy, in a way that consumes much energy. Therefore it is logical to assume that the kingbird will consume more prey to better sustain its rigorous feeding habits.

To learn more visit:

brainly.com/question/845236?referrer=searchResults

5 0
2 years ago
Other questions:
  • What type of human inventions contribute to release of CO2 on earth​
    13·1 answer
  • Where might be a good place to set up this measuring tool? Explain
    7·2 answers
  • How would i illustrate and explain the difference in kinetic energy and potential energy?
    11·1 answer
  • The Hershey and Chase experiments involved the preparation of two different types of radioactively labeled phage. Which of the f
    8·1 answer
  • A titratable group is in the active site of an enzyme and must be protonated for the enzyme to function. Assume that the group h
    5·1 answer
  • I cant find anything on this please help
    14·1 answer
  • WHAT IS THE ANSWER????
    10·1 answer
  • NEED ANSWERED ASAP
    14·1 answer
  • PLZ HELP FREE BRAINLIST!!!!
    7·2 answers
  • 11. The only freely moveable bone in the skull is the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!