W a t e r ahhhh 8228c+x Skansen 2828
Explanation:
Cells are the basic building blocks of all living things. The human body is composed of trillions of cells.
cells are bigger than atoms. We can see cells with a microscope. Just as atoms have smaller parts called protons, neutrons, and electrons, cells have smaller parts, too. When you look at cells with a powerful microscope, you can clearly see hundreds of them.
Answer:
the first at the top is a fundus the one down to its right is the faloppian tube and on the other side pointing to the white is an ovary the one under ovarys is the myometrium then the last is the vagina
Explanation:
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
It is safe to assume that the eastern kingbird will have a <u>type 2 </u><u>functional response </u><u>to an increase in </u><u>prey abundance</u><u>.</u>
The functional response, in ecology, is a data-based description of the behavior of certain animals' consumption rates in response to a change in prey density. This can be of three kinds:
- Type 1: An increase in consumption
- Type 2: A decrease in consumption
- Type 3: Decreased consumption, followed by a quick increase.
The Eastern kingbird is likely to follow a <u>type 1 </u><u>functional response</u> to the presence of more prey. The reason for this, aside from it being the most common response, is that the eastern kingbird consumes insects, which do not provide a great amount of energy, in a way that consumes much energy. Therefore it is logical to assume that the kingbird will consume more prey to better sustain its rigorous feeding habits.
To learn more visit:
brainly.com/question/845236?referrer=searchResults