1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
m_a_m_a [10]
3 years ago
10

Is a fox a heterotroph or a autotroph

Biology
1 answer:
rosijanka [135]3 years ago
3 0
A fox is a heterotroph
You might be interested in
someone help me with this question please: What is the job of ribosomes? Please answer as soon as possible its related to my pro
Romashka-Z-Leto [24]

Answer:

Production of proteins

Explanation:

Ribosomes consist of RNA's and special proteins that help to synthesize other proteins. Ribosomes can be found either floating within the cytoplasm or attached to the endoplasmic reticulum. They

7 0
2 years ago
Read 2 more answers
Which flow chart best shows the relationship between the cell structures that are listed? ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
vaieri [72.5K]
Here is the correct flow chart: GENE > DNA > CHROMOSOMES > NUCLEUS.
The cell nucleus contain chromosomes which are made from long DNA molecules. A gene is a short section of a DNA which codes for a specific protein.
5 0
3 years ago
Read 2 more answers
How does this snake obtain nutrients from corn? A. By living in the cornfield B. By eating the corn directly C. By eating the gr
Mashutka [201]

Answer:

By eating the lizard most likely because based on the ecological food chain, a snake can get the nutrients from the lizard if the it ate corn

Explanation:

i took the test

3 0
2 years ago
Read 2 more answers
Which bones make up the elbow joint? 
Nataly [62]
The elbow is made up of the humerus, radius and ulna so your answer is A
7 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Other questions:
  • Name three ecosystem services provided by biodiversity.
    12·2 answers
  • The nematode cuticle contains _____.<br><br> glucose<br> skin cells<br> chitin<br> nerve cells
    12·1 answer
  • Each gram of glucose contains approximately how much energy
    5·1 answer
  • How do wild horses keep their hooves short?
    9·1 answer
  • Most homeostatic systems are ____? extrinsic, intrinsic, both, none of the above
    12·1 answer
  • PLEASE HELP ASAP! PLEASE DO NOT GIVE ME A VIRUSES!
    6·2 answers
  • A layer of sandstone is found on top of a layer of shale. what most likely happened in this area?
    7·1 answer
  • How can i compare school to a vacuole​
    6·1 answer
  • On the data tab, select every organism. What happens to the reef populations?
    7·1 answer
  • Does anyone have the answer key to the "muscles and bones gizmo student exploration"?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!