1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
charle [14.2K]
3 years ago
12

Florida is bordered by water on three sides. Which property of water helps moderate Florida’s coastal areas?

Biology
1 answer:
Alex3 years ago
4 0
It is unclear what is meant by 'moderate Florida's coastal areas'. I assume the question relates to climate. The answer would then be that the water moderates the temperature of Florida. This is because water<span> has a very high heat capacity and a lot of heat energy is required to result in a small change in </span>temperature<span>. So it is likely that the climate of Florida would experience much greater extremes if it was not surrounded by water.</span>
You might be interested in
Describe the effect of mutation
lilavasa [31]
Some don't have any able to see effects,but some cause diseases
8 0
3 years ago
Atmosphere of the early earth + lighting =
Softa [21]
Atmosphere of the early earth + lighting = paleolightning
5 0
3 years ago
Read 2 more answers
In order for proteins synthesis to acquire both transcription and translation must occur which of the following statements descr
pashok25 [27]
Answer: In transcription, the genetic code of a DNA molecule is encoded. Translation is the process of converting DNA Code into a code that RNA can use.
3 0
2 years ago
What is diamond ?how it formed?why it is so precious?
serious [3.7K]

Answer:

Diamond is a solid form of the element carbon with its atoms arranged in a crystal structuctre. It is formed in the mantle and delivered to the surface by deep source volcanic eruption.

Explanation:

it have exquisite beauty, inner fire, and unique physical quantity have made them so precious.

5 0
2 years ago
During cellular respiration, every living thing in this food web uses ______ gas and releases ______ back into the environment
nordsb [41]
Oxygen; carbon dioxide
3 0
3 years ago
Read 2 more answers
Other questions:
  • Proper use of a condom during sexual activity does not guarantee protection against stis.
    14·1 answer
  • why can eukaryotes carry out more specialized functions than prokaryotes can? A) eukaryotes have more organelles B) Prokaryotes
    6·1 answer
  • What are the tree types of symbiotic relationship
    9·2 answers
  • When plants grow towards sunlight, they __________.
    14·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Hannah has information about an object in circular orbit around Earth.
    13·1 answer
  • Describe an event that must occur in order for diamond
    6·1 answer
  • Which of the following is a monosaccharie?
    9·1 answer
  • Which statements accurately describe the structure of the cell membrane? Check all that apply. The cell membrane is a single lay
    6·2 answers
  • Using the diagram below, identify the ONLY portion of the nucleotide that is not the
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!