Answer:
30.4 g. NH3
Explanation:
This problem tells us that the hydrogen (H2) is the limiting reactant, as there is "an excess of nitrogen." Using stoichiometry (the relationship between the various species of the equation), we can see that for every 3 moles of H2 consumed, 2 moles of NH3 are produced.
But before we can use that relationship to find the number of grams of ammonia produced, we need to convert the given grams of hydrogen into moles:
5.4 g x [1 mol H2/(1.008x2 g.)] = 2.67857 mol H2 (not using significant figures yet; want to be as accurate as possible)
Now, we can use the relationship between H2 and NH3.
2.67857 mol H2 x (2 mol NH3/3 mol H2) = 1.7857 mol NH3
Now, we have the number of moles of ammonia produced, but the answer asks us for grams. Use the molar mass of ammonia to convert.
1.7857 mol NH3 x 17.034 g. NH3/mol NH3 = 30.4 g. NH3 (used a default # of 3 sig figs)
Answer:
219.95 °C
Explanation:
Given data:
Volume of gas = 9.71 L
Initial pressure = 209 torr (209/760 = 0.275 atm)
Initial temperature = 10.1 °C (10.1 +273 = 283.1 K)
Final temperature = ?
Final pressure = 364 torr (364/760 =0.479 atm)
Solution:
According to Gay-Lussac Law,
The pressure of given amount of a gas is directly proportional to its temperature at constant volume and number of moles.
Mathematical relationship:
P₁/T₁ = P₂/T₂
Now we will put the values in formula:
0.275 atm / 283.1 K = 0.479 atm/T₂
T₂ = 0.479 atm × 283.1 K/ 0.275 atm
T₂ = 135.6 atm. K /0.275 atm
T₂ = 493.1 K
Kelvin to °C:
493.1 K - 273.15 = 219.95 °C
The answer is Photosphere Apex.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
2Fe + 3H2SO4 + Fe2(SO4)3+ 3H2
Explanation:
1. Fe (SO4) 3 is an incorrectly written formula because iron is trivalent as we can see by this three ahead of SO4. SO4 is divalent always.
2. since (SO4) is 3, this three shows us that there must be 3 in the reactants as well.
so now there is 3H2SO4
3. Since we have added 3 to one hydrogen we must add another. So now it's 3H2
4. and finally iron. In Fe2 (SO4) 3 we see this 2 in front of Fe which means it goes 2Fe.
