1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artist 52 [7]
3 years ago
12

Which body systems are involved in the removal of waste? Choose more than one answer.

Biology
2 answers:
ladessa [460]3 years ago
5 0

Answer:

excretery because it has the parts of the body which help to excrete waste that forms in our body

wlad13 [49]3 years ago
3 0

Answer: how do I delete an answer

You might be interested in
The only food source for plants is glucose. Describe how plants are able to produce all other necessary biomolecules. Use the wo
olasank [31]
Me toooooooo but girl go to thisisstudy
4 0
2 years ago
Read 2 more answers
The nucleotide sequence of a DNA codon is TAG. In an mRNA molecule transcribed from this DNA, the codon has the sequence _______
inna [77]

Answer:

The nucleotide sequence of a DNA codon is TAG. In an mRNA molecule transcribed from this DNA, the codon has the sequence 5'-<u>AUC-3'</u>. In the process of protein synthesis, a transfer RNA pairs with the mRNA codon. The nucleotide sequence of the tRNA anticodon is <u>3'-UAG-5'</u>. The amino acid attached to the tRNA is <u>Isoleucine</u>.

Explanation:

In the process of protein synthesis the mRNA contains the sequence of nucleotides —transcribed from the DNA— that defines the sequence of amino acids that a synthesized protein will have.

Codons are triplets of nitrogenous bases present in mRNA, which encode an amino acid, as well as the start and end of protein synthesis.

Anticodons correspond to triplets of bases present in transfer RNA (tRNA), which correspond with mRNA codons. tRNA is responsible for coupling amino acids to the polypeptide chain being synthesized. In view of this:

<em>- DNA triplet:               TAG</em>

<em>- Codon mRNA:      5'-AUC-3' </em>

<em>- Anticodon tRNA:   3'-UAG-5'</em>

<em>- Amino acid:           Isoleucine</em>

3 0
3 years ago
Which is the correct order of energy change from greatest to least from chemical,physical, and nuclear
OLEGan [10]

Answer:

physical, chemical, nuclear

Explanation:

6 0
3 years ago
Temperate continental climate
MatroZZZ [7]

In the temperate latitudes, a continental climate is usually characterized by a large annual range of air temperature (hot summers and cold winters) and considerable daily variations in air temperature. A continental climate differs from a marine climate in having a low mean annual temperature, low humidity, and dustier air.

3 0
3 years ago
What are brodmann areas and how do they relate to the neurological deficits that occur as the result of stroke?.
Viefleur [7K]

The Brodmann areas are a method of mapping the cortex and its distinct functions that was developed by Korbinian Brodmann, after whom the areas are named.

Korbinian Brodmann (November 17, 1868 – August 22, 1918) was a German neurologist best known for classifying the cerebral cortex into 52 distinct regions based on cytoarchitectonic (histological) characteristics. These areas are now commonly known as Brodmann areas.

The Brodmann classification divides the cortex into approximately 52 sequentially numbered areas, though some regions have since been subdivided and others are only found in non-human primates.

It is in charge of motor movements such as contralateral finger/hand/wrist or orofacial movements, learned motor sequences, breathing control, and voluntary blinking. The primary visual cortex (Brodmann area 17) is located on the medial surface of the occipital lobe, in and on either side of the calcarine sulcus.

To learn more about Brodmann areas, here

brainly.com/question/15837481

#SPJ4

3 0
11 months ago
Other questions:
  • A large variety of grass species, wildflowers, fruit trees, snow leopards, and mountain goats are found in the
    9·2 answers
  • How do vectors contribute to the spread of disease?
    5·1 answer
  • What are two ways scientists can<br> describe the quality of<br> measurements?
    8·1 answer
  • Hot spots can also be found along plate boundaries? True or false.​
    6·1 answer
  • What is a human egg cell
    13·2 answers
  • What type of mutation is shown in the picture provided?
    10·1 answer
  • List two natural disturbances and two human-made disturbances that can lead to succession
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Genetics Movie
    9·2 answers
  • Is a scientific hypothesis accepted if there is no way to demonstrate that the hypothesis is wrong? Explain your answer.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!