1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Monica [59]
4 years ago
14

Which statement distinguishes the light-dependent (L-D) reaction from the light-independent (L-IND) reaction?

Biology
2 answers:
Alja [10]4 years ago
4 0


The correct answer is  (a).

Both L-D and L-IND reactions take place in the chloroplast of the cell but in different parts or locations. L-D reactions take place in the chloroplast thylakoids while L-IND reactions take place in the chloroplast stroma.

Chloroplasts are chlorophyll- filled organelles mostly found in the leaves of green plants.  Chloroplasts are surrounded by a double membrane called the thykaloid membrane that forms long folds within the organelle. In electron micrographs, the thykaloid membranes look like stacked coins. Chlorophyll is located within the thykaloid membranes.

Between the thykaloid  membrane and the chloroplast membrane is a space. This space is what is called the stroma.




maksim [4K]4 years ago
4 0

Answer:

its a

Explanation:

You might be interested in
A dermatome represents the motor innervation of muscles in what area.
Anon25 [30]

Answer:

A dermatome represents the unilateral area of skin on the body that is innervated by fibers from the sensory portion of a single spinal nerve coming from the spinal cord. Each spinal nerve contains spinal roots (anterior and posterior) that come together to form the spinal nerve.

Explanation:

3 0
3 years ago
Fungi are classified based upon
Softa [21]
Fungi are classified based upon how they reproduce. The rest of the factors do not include anything of their classification.
5 0
3 years ago
Kelp can be described as . a. slow growing aquatic plants. . b. slow growing algae . c. fast growing fungi . d. fast growing alg
romanna [79]
Kelp can be described as <span>fast growing algae. The correct option among all the options that are given in the question is the fourth option or option "d". It is a unique kind of an algae that has the capability to grow 2 feet in a day under right conditions. I hope that this is the answer that has come to your great help.</span>
4 0
3 years ago
Question 4 (1 point) If 18 grams of oxygen reacts completely with 4 grams of hydrogen, we would expect how many grams of water?
Lisa [10]

Answer:

C.22 grams because mass cannot be created or destroyed

Explanation:

Reaction equation:

        2H₂  +   O₂    →   2 H₂O

Mass of oxygen  = 18g

Mass of hydrogen  = 4g

The mass of water produced is 22g according to law of conservation of mass.

The law states that " in a chemical reaction, mass is always conserved"

 The sum of the mass of product  and reactants must always be the same.  

6 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Other questions:
  • Loss of motor and sensory control of the trunk of the body and lower extremities because of a spinal cord injury describes _____
    11·1 answer
  • Why is reproduction considered as a life function?
    9·2 answers
  • Which would be best categorized as heat transfer by convection? A) Wearing a white shirt to stay cool on a summer day. B) Noodle
    13·2 answers
  • True or False. An action potential can exist when both sides of the cell membrane have the same charge.
    7·2 answers
  • Unlike DNA, RNA is ___
    13·1 answer
  • How does food move through your digestive tract? Is it voluntary (do you control it) or involuntary? What is the process called?
    9·2 answers
  • How does tempurature and ph affect enzymes?
    9·2 answers
  • MARK AS BRAINLIEST HELP ASAP!!
    15·2 answers
  • The larvae of frogs are called ___________. <br> tadpoles <br> toadstools <br> pups <br> hatchlings
    5·2 answers
  • How is the food chain related to the web of life?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!