1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Likurg_2 [28]
4 years ago
9

Please help!

Biology
2 answers:
Alchen [17]4 years ago
6 0
The answer to your question would be B
Aliun [14]4 years ago
5 0
For this question It’s A
You might be interested in
During respiration, which reactant molecules do the C atoms in Co2 come from? Do they from the oxygen or the glucose
Alexxx [7]

Answer:

This reaction shows that all of the atoms in the glucose and oxygen gas reactants are accounted for in the carbon dioxide and water products. The reactions of cellular respiration can be grouped into three stages: glycolysis, the Krebs cycle (also called the citric acid cycle), and electron transport.J

Explanation:

bc i know

4 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Part A. What is the most common plant in the tundra?
malfutka [58]

Answer:

Part A)  Arctic Moss

Explanation:

7 0
3 years ago
if a person moved from san diego CA to estes park CO (elevation 7500ft) what would be the effect on cellular respiration for thi
bekas [8.4K]

The atmospheric pressure drops so the partial pressure of O2 drops proportionately. The hemoglobin must circulate faster to deliver the same quantity of oxygen to working muscles' mitochondria for cellular respiration. This increased basal circulation rate places a greater demand for oxygen to support it, which triggers in increase in red blood cell population so there is more hemoglobin to deliver O2. With more RBCs the circulation rate once more slows to the old basal rate.

8 0
3 years ago
Next-generation sequencing reveals six new mutations have occurred in the coding regions of genes in an individual diploid fly.
Bingel [31]
10^{-8} mutations per nucleotide. If there are 100 million nucleotides per haploid genome, there are 200 million nucletides per diploid genome. Six mutations divided by 200 million is 10^{-8}.   
5 0
3 years ago
Other questions:
  • How do the respiratory and circulatory depend on each other for gas exchange?
    12·1 answer
  • Autotroph in a sentence
    11·1 answer
  • Classfication of living being is necessary justify​
    15·1 answer
  • When double-stranded dna is heated to 95°c, the bonds between complementary base pairs break to produce single-stranded dna. con
    15·1 answer
  • Your bacterium is growing on a type of medium called casein agar, which contains milk protein (casein). There is a clear zone ar
    15·1 answer
  • Eric has blood type O. What could be the genotype of his grandmother Tricia? Select all that apply.
    6·1 answer
  • What part of a nucleic acid allows it to be used to form a code
    14·2 answers
  • What is speed of bobsled whose distance time graph indicates that it traveled 122m in 25 s
    5·1 answer
  • The haploid cells that join during sexual reproduction are called
    14·2 answers
  • Which option represents qualitative data?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!