1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kherson [118]
2 years ago
7

Match the correct ones together

Biology
1 answer:
Serhud [2]2 years ago
4 0

<em>Hello-</em>

<em>The Biosphere option would match with the answer concerning plants (the bottom right box) since the biosphere concerns living things.</em>

<em>The Hydrosphere option would match with the answer concerning rain (the middle right box). Hydro = water.</em>

<em>The Lithosphere option, then, would go with the last remaining answer, concerning volcanoes (the top right box).</em>

<em />

<em>I hope this answers your question.</em>

You might be interested in
Why do plants need water?​
ANTONII [103]

Explanation:

plants need water for the process of photosynthesis and transpiration

6 0
2 years ago
Read 2 more answers
Consider the food chain of grass → grasshopper → mouse → snake → hawk. about how much of the chemical energy fixed by photosynth
Komok [63]
0.1%, use the 10% rule. 
5 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Matter takes up space and has mass or weight.<br> True<br> False
Dima020 [189]

Answer:

Explanation:All matter has mass and occupies space. All physical objects are made of matter. Matter itself is composed of tiny building blocks known as "atoms".

4 0
2 years ago
Firewood is made up of cellulose, which is a polymer of glucose molecules. When burning, heat and light are given off, indicatin
skelet666 [1.2K]

Answer:

Exergonic reaction

Explanation:

  • A chemical reaction which is associated with a release of energy and thus, is associated with a negative free energy change is said to be an exergonic reaction.
  • An exergonic reaction owing to the negative free energy change is a spontaneous reaction.
  • The energy that is released in the exergonic reaction is usually observed  in the form of heat and light.
  • The energy is released due to the breaking of the chemical bonds.
  • Therefore, on burning of the firewood the bonds between the glucose molecules break up which leads to the release of energy in the form of heat and light and this is thus, an example of an exergonic reaction.
7 0
3 years ago
Other questions:
  • In your own words, explain a crucial piece of evidence that an ancient Greek astronomer could have used to support the geocentri
    10·2 answers
  • Demonstrate through chemical modeling what happens to the protein structure (keratin) of curly hair after a chemical relaxer and
    10·1 answer
  • Characteristics of volume
    5·1 answer
  • Which of the following can wear away the solid rock of a cliff over time
    12·1 answer
  • Which is most likely a chemical property?
    9·2 answers
  • PLEAS HELP!!!!!
    6·1 answer
  • The danger of crops becoming extinct before scientists can study them is
    15·1 answer
  • Suppose the DNA sequence GCT ATA TCG was changed to GCTАТТ TCG. How would the products of translation, the amino acids, be affec
    10·2 answers
  • In the free association technique of psychoanalysis, the______.
    5·1 answer
  • What is a petals reproductive function?<br> PLEASE GIVE A WELL WRITTEN ANSWER<br> No gooogle
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!