1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adoni [48]
3 years ago
14

Aquatic organisms that lived hundreds of millions of years ago and were buried in silt and sediment resulted in the formation of

_______. a. coal b. biomass c. biofuels d. petroleum Please select the best answer from the choices provided A B C D
Biology
2 answers:
kakasveta [241]3 years ago
4 0

Answer: c. biofuels

Explanation:

A biofuel is the fuel that is produced by the biological activity of anaerobic microorganisms rather than a fuels that are generated by the geological processes such as coal and petroleum. The biofuels will form after the decaying and decomposition of the organic matter generated after the death of aquatic animals when left buried under the heap of the silt and sediments.

Dmitriy789 [7]3 years ago
3 0
I think it's C I'm not sure
You might be interested in
How are Osmosis and Diffusion alike?
valkas [14]

Osmosis is the movement of water and is always the movement in the membrane. Diffusion does not need a membrane to make molecules and Diffusion is the movement of molecules. they do not require energy, they both move from a high concentrate to a low concentrate, and they both occur in plants and animals.

5 0
3 years ago
There are several cell types found in the plasma of our blood. which cell type is essential for forming clots that prevent us fr
maria [59]
I want to say the answer is Plasma

6 0
3 years ago
Plasmid bacteria have been developed to produce insulin, which is used by many diabetes patients. Which group of scientists MOST
blagie [28]
I am pretty sure it is <span>D. Microbiologist</span>
6 0
3 years ago
Read 2 more answers
How would consuming less than 1200 calories per day impact metabolism?
tatyana61 [14]
By consuming less than 1200 calories a day it impacts a person’s metabolism by slowing it down and forcing the body to break down its own tissues if it is not receiving sufficient calories to withstand vital functions. There are slight side effects of a less than 1200 calories which are faintness, tiredness, irregular periods, and unsteadiness. Some major side effects might have impact on the gallbladder, gout, excruciating inflammation of the joints and also death.
7 0
3 years ago
Which describes one way that renewable resources differ from nonrenewable resources? Renewable resources make cleaner energy. It
Assoli18 [71]

Answer:

Renewable resources make cleaner energy. It takes longer to replenish renewable resources. Renewable resources are more easily located and harvested. It often costs much less to produce energy from renewable resources.

7 0
2 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP ME!!!!!!!
    11·1 answer
  • Simon and his friends are working on an experiment to determine the most common blood type group in California. Which of these m
    9·2 answers
  • A scientist is studying the metabolism of proteins in yeast and wants to follow the formation of proteins from the earliest poss
    8·1 answer
  • I need help because i dont really know how to do this
    11·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The rock pocket mouse (Chaetidipus intermedia) is a species of rodent commonly found in the desert of Mexico and the southwester
    14·1 answer
  • How does this show the relationship between photosynthesis and cellular respiration​
    9·1 answer
  • Identify What system moves blood<br>through the body?<br>​
    10·2 answers
  • I need help with this problem. Thanks ‍♀️
    11·2 answers
  • HELPP PLEASEEEE......​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!