1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alecsey [184]
3 years ago
5

What do ligaments hold together in a joint?

Biology
2 answers:
galben [10]3 years ago
7 0
Ligaments<span> - a tough band of tissue that holds the ends of bones </span>together<span> at a </span>joint Joints<span> - where two or more bones meet </span>together<span> Tendons - cords of connective tissue that attach muscle to bone Muscles and tendons attach to bones on either side of a </span>joint<span>, </span>holding<span> the bone(s) </span>together<span> tightly In the human body</span>
jeka57 [31]3 years ago
3 0
In a joint, ligaments hold the ends of bones together. :)
You might be interested in
The human eye can detect wavelengths between 400 nm and 700 nm. The sky appears blue (490 nm) due to the scattering of visible l
kondor19780726 [428]

Answer:

In the electromagnetic spectrum, the visible spectrum is the part, which is perceptible to the human eye. The electromagnetic spectrum in this array of wavelengths is known as simply light or the visible light. A general human eye will react towards the wavelengths in the range between 380 to 740 nm. A human eye sees the sky as blue that comes in the wavelength 490 nm because of the scattering of the visible light by the particles in the atmosphere. This concludes that 490 nm is the sole wavelength, which is reaching the eye.

3 0
3 years ago
If a corn plant has a genotype SsTt, what are the possible genetic combinations that could be present in a single grain of polle
wolverine [178]

The maize plant possesses the SsTt genotype.

The F1 generation will produce the children depicted in the punnet square after they are crossed.

<h3>What is pollen grain?</h3>

A seed plant's pollen is a collection of microspores that typically takes the form of a fine dust. Each pollen grain is a tiny body with a unique shape and structure that develops in seed-bearing plants' male structures before being carried by a variety of agents (such as wind, water, insects, etc.) to the female structures, where fertilization takes place.

The genotype in question is a mono-hybrid heterozygous characteristic.

The pollen grains having a genetic combination like ST, St, sT, and st as depicted in the image will result from a cross between the two genotypes.

For more information regarding pollen grain, visit:

brainly.com/question/20638294

#SPJ1

6 0
2 years ago
A function of another type of white blood cell is to
Lyrx [107]
The main function of white blood cells is to help protect the human body from infection as well as other foreign materials. White blood cells are also known as leukocytes, and they develop in bone marrow from stem cells. There are five different types of white blood cells<span>, including neutrophils, lymphocytes, monocytes, eosinophils and basophils.</span>
4 0
3 years ago
Why does active transport require energy?
AleksAgata [21]
Because the molecules that are being transported is moving against its concentration. gradient. in other words, its moving from where it's low in concentration to where it's high in concentration.
3 0
3 years ago
Could an organism survive without one of its organs?
dusya [7]
A human can survive with only one kidney
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these is most likely true for two organisms, A and B, in parasitism?
    13·2 answers
  • Help me on number 12 and 13!
    7·1 answer
  • Malignant tumors are classified according to
    14·1 answer
  • What body system does this structure belong?
    12·1 answer
  • Denise heats a beaker of dilute acid on a hot plate in a fume hood. What should Denise wear to best protect herself when she tra
    6·2 answers
  • What is missing from this food chain
    7·2 answers
  • What happnend to addie in 2012 the sick girl
    15·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • Christina and her friends are discussing the theory of evolution. One friend states that there is no evidence to support the the
    8·1 answer
  • ____ muscle is voluntary and straited; _____ muscle is involuntary and non striated?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!