1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLEGan [10]
3 years ago
7

The glucose-making part of photosynthesis take place in what

Biology
1 answer:
swat323 years ago
6 0

Answer:

The glucose making part of photosynthesis takes place in the stroma.

Explanation:

You might be interested in
Translation or protien synthesis is a
Gnesinka [82]

Answer:

Multi-step process

Because it can be done twice or more

5 0
3 years ago
State the monosaccharaides that form these isaccharides​
Minchanka [31]

Answer:

Explanation:

Well the question was a little unclear, but for disaccharides:

(alpha) Glucose + (alpha) Glucose = Maltose

(alpha) Glucose + Fructose = Sucrose

(alpha) Glucose + Galactose = Lactose

4 0
3 years ago
Did earth experience normal or reverse polarity 1.5 million years ago
azamat

Normal polarity

Explanation:

Earth's magnetic field used to be twice as strong 1.5 billion years ago as it is today and Earth's temperature other than what the geologists see from the 'normal' pattern. It has been noticed that some volcanic rocks were magnetized in opposite direction to the direction of the local Earth's field. It is clear that the Earth has experienced the normal polarity 1.5 years ago but at that time, the Earth's polarity was poorly understood.

7 0
3 years ago
When a species changes in response to change in the environment, we call this ______.
Leona [35]

Answer: Adaptation

species adapt to their environment

8 0
3 years ago
Why can’t a virus reproduce on its own?
monitta

Answer:

<h3>Viruses can only replicate themselves by infecting a host cell and therefore cannot reproduce on their own.</h3>

<h3>At the most basic level, viruses consist of genetic material contained within a protective protein coat called a capsid; the existence of both genetic material and protein distinguishes them from other virus-like particles such as prions and viroids.</h3>

<h3>They infect a wide variety of organisms: both eukaryotes (animals, fungi and plants) and prokaryotes (bacteria).</h3>

<h3>A virus that infects bacteria is known as a bacteriophage, often shortened to phage.</h3>

<h3>The study of viruses is known as virology, and those who study viruses are known as virologists.</h3><h3 /><h3>It has been argued extensively whether viruses are living organisms.</h3>

<h3>Most virologists consider them non-living, as they do not meet all the criteria of the generally accepted definition of life.</h3>

<h3>They are similar to obligate intracellular parasites as they lack the means for self-reproduction outside a host cell, but unlike parasites, viruses are generally not considered to be true living organisms.</h3>

<h3>A primary reason is that viruses do not possess a cell membrane or metabolise on their own - characteristics of all living organisms.</h3>

<h3>Examples of common human diseases caused by viruses include the common cold, the flu, chickenpox and cold sores.</h3>
7 0
2 years ago
Other questions:
  • Cells that can divide indefinitely, renew themselves, and give rise to a variety of other types of cells are called _____ cells.
    9·1 answer
  • Where would muscle A in the image set most likely be found?
    8·2 answers
  • Which of the following is NOT a function of an antibiotic?
    11·1 answer
  • A German company specializes in building laboratory rooms for handling dangerous viruses and bacteria. Each room is designed to
    15·1 answer
  • How are coral reefs similar to tropical rainforests? Both are home to just a few types of rare animals. Both can easily be resto
    6·2 answers
  • Black fur (B) is dominant. Find the probability of a black offspring in a cross: bb x bb.
    7·1 answer
  • Recall Characteristics of Cells WARM-UP Choose the statements below that are true. Cells are the smallest unit of life. Cells ar
    12·2 answers
  • What do you think selectively permeable means?
    5·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Name the three cultural revolutions that helped support the rapid rise in population. Explain how these
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!