1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mixer [17]
3 years ago
6

Suppose a woman with a continuous hairline and short fingers and a man with a widow’s peak and long fingers have three children.

One child has short fingers and a widow’s peak, one has long fingers and a widow’s peak, and one has long fingers and a continuous hairline. What are the genotypes of the parents
Biology
1 answer:
sergeinik [125]3 years ago
5 0

Answer:

The women has a genotype of hhff and the man has a genotype of HhFf

Explanation:

From the results of the children we can see that widows peak and long fingers are dominant because it has the majority in the family. The question is are the parents homozygous dominant. The are not. They are heterozygous because if they were homozygous they wouldn’t be able to have any recessive genes transfer to the children

You might be interested in
Which statement is accurate about snowflakes?
bonufazy [111]

Explanation:

The last one is the answer

hope it's correct

6 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
How are plant cells and human cells different?
jeka57 [31]
It is c I believe cause the human cells can’t make their own food like plants do when they photosynthesis
3 0
3 years ago
Read 2 more answers
Seeds are a derived character of the spermatophytes. All of the plants in this clade reproduce using seeds. However, embryo form
Natasha2012 [34]

Embryophyta is a clade within the Phragmoplastophyta, a larger clade that also includes several green algae groups. Embryophytes are the plants growing on land which include hornworts, liverworts, gymnosperms, flowering plants etc while green algae mostly thrive in aquatic environment.

The conduction of water requires vascular tissue called xylem. In green algae, it is not necessary to have water conducting tissue as the entire body is in contact with water. However in embryophytes, having a vascular tissue is an adaptation that ensures to provide water to the higher parts of the plant which is not directly in contact with the soil.

4 0
3 years ago
How does the root and shoot system function together?<br> Please help!!
Rzqust [24]
Plant Root and Shoot System. Plants have two Organ Systems: the shoot system and the root system. Stems have many jobs, including supporting the plant; acting like the plant's plumbing system, conducting water and nutrients from the roots and food in the form of sugar (glucose) made in the leaves to other plant parts.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Why are biologists concerned about ecosystem disruption? (EXTRA POINTS)
    5·1 answer
  • The ends of eukaryotic chromosomes are called ____________ .
    13·1 answer
  • Select the description of mRNA. a.a three‑dimensional complex of ribonucleotides and proteins that assembles polypeptide chains
    12·1 answer
  • A population is a population is a group of individuals of the same species that live in the same area and interbreed. all indivi
    15·1 answer
  • Which of the following best describes the relationship between methane recapture systems and sustainable farming techniques?
    8·1 answer
  • During glycolysis, a six-carbon glucose is broken down into two, three-carbon pyruvate molecules. Which molecules provide the en
    15·2 answers
  • OMG! Another review question? We are
    11·2 answers
  • You have three jars containing marbles, as follows: jar 1: 600 red and 400 white jar 2: 900 blue and 100 white jar 3: 10 green a
    14·1 answer
  • What is necessary for the process of active transport to occur
    9·1 answer
  • What echinderm has a stomach outside its mouth.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!