Answer:
what are we supposed to help you with
In the matrix of mitochondria the reactions known as the citric acid or Krebs cycle produce a chemical called NADH. NADH is then used by enzymes embedded in the mitochondrial inner membrane to generate adenosine triphosphate (ATP). In ATP the energy is stored in the form of chemical bonds.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
a. People with celiac disease should include foods with dietary fiber such as beans, fruits, vegetables, brown rice, and quinoa.
e. Home-cooked meals are a good way to increase variety and reduce the cost of a gluten-free diet.
Explanation:
Celiac disease is an autoimmune disease, as stated above. This disease causes the defense cells of an organism to attack the stomach cells causing an inflammation that is extended and stimulated by the glutem. As a result, the individual has diarrhea, constipation, weight loss, anemia, a feeling of fullness, colic, abdominal discomfort, severe pain and may even develop ulcers and cancers.
Glutem is a protein found in wheat, barley and rye and for that reason, individuals with this disease should avoid these foods or foods derived from them. This type of diet should accompany the sick person for life and they should be encouraged to eat homemade foods that know the origin and composition. In addition, it is necessary that these people feed on dietary fibers, such as beans, fruits, vegetables, brown rice and quinoa.
