Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Why is understanding mitts important?( Select the best answer)
1.It helps us understand how organisms repair.
2. It helps us understand how organisms grow.
3. It is important for cancer research.
4. All options correct.
The type of energy that comes from the movement of small particles is thermal energy, as the movement of particles produces thermal energy as a result.
<h3>What is it called or particle motion?</h3>
Concept Brownian is the random motion of particles in a fluid (liquid) as a consequence of all changes such as the gas or movement of those present in the fluid.
With this information, we can conclude that On the motion of small suspended particles within liquids at rest, as required by the kinetic molecular theory of heat
Learn more about movement of small particles in brainly.com/question/2052169
#SPJ1
Answer: Growing season is short because of it's cold climate.
Explanation:
Tundra is an area of the Earth that has no trees and the climate is cold and windy. There is little rainfall and it is found in top mountains and artic region. The growing season in tundra is very short, usually between 6 to 10 weeks. The temperature is low and cold because there are permafrost that are under the ground, evaporation of water is low because of low temperature.
