1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dusya [7]
3 years ago
5

How does fossil fuel use harm our planet? Please I need an answer ASAP!!!!!

Biology
1 answer:
Lubov Fominskaja [6]3 years ago
6 0

Answer:

Fossil fuels produce carbon emissions that contribute to the greenhouse effect. The greenhouse effect is heating up the Earth's atmosphere and causing global warming.

Explanation:

You might be interested in
During the rock cycle, rocks get broken apart by weathering, carried along by erosion, and eventually deposited in a body of wat
vagabundo [1.1K]
After many years of pressure and possibly heat it will be compressed back into a form of rock such as sediment.
8 0
2 years ago
Read 2 more answers
What is the rarest animal on earth?
Alexus [3.1K]

Answer:

book trout

Explanation:

6 0
2 years ago
Read 2 more answers
A woman who is breastfeeding is not able to eat enough food for two weeks because of a lack of money. What effect will it have o
NikAS [45]

Answer:

There will not be any effect because the body will continue to produce enough.

Explanation:

Producing breast milk to satisfy a starving newborn is an arduous and energy-intensive task - about 500 calories a day. Therefore, it is important that moms a little more than normal. If the mother eats little, her body will still produce good quality milk, but she will run out of energy. This can also slow the recovery of your body after childbirth.

What determines milk production is how often the baby breastfeeds or how much more the mother empties her breasts. That is, the more the baby suckles, the more milk the mother will have. This milk will always be the amount of nutrients a baby needs, regardless of whether or not the mother has eaten. But if the mother does not eat, she may have health problems.

8 0
2 years ago
Which of the following statements is true?
Anna35 [415]
The answer will probably be b
5 0
3 years ago
A feral cat needs to eat two mice a day to survive. A mouse needs to eat 5 seeds a day to survive. How many seeds are required t
Mars2501 [29]

Answer:

70 seeds

Explanation

5 is the food for a mouse  (day)x2 mice for cat=10. 10x7(week)=70 seeds

hope this helps!

3 0
3 years ago
Other questions:
  • The aleutian islands extend westward from southern Alaska to form the northern boundary of the Pacific Ocean. These volcanic isl
    9·1 answer
  • How do mitosis and meiosis differ in the division of genetic composition?
    13·2 answers
  • In a population of spiders, there is a protein that is coded in the DNA to make venom. In a particular spider, there was a prote
    9·1 answer
  • Please help me it would mean the world
    6·1 answer
  • What happens as a result of osmosis when an animal cell containing 1% sugar is placed in pure water
    11·1 answer
  • In a further experiment, the researchers add a compound to the cell growth medium that both binds and releases protons (H+) and
    11·2 answers
  • What types of evidence allow scientists to infer that single-celled life likely existed 3.8 billion years ago? Select all that a
    8·1 answer
  • Plz help me with this....
    11·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Hey guys i need help with an assignment and I need the answer quick
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!