1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novosadov [1.4K]
3 years ago
12

What strengthens the cell membrane?

Biology
1 answer:
pochemuha3 years ago
3 0
The walls of the cell membrane is what strengthens it
You might be interested in
List The major subdivisions or components for each of the four types of compounds carbohydrates lipids proteins and nuclear acid
gayaneshka [121]
The living organism is to make the capability of making your own way of inspiring new ways to inductor the situation on a problem to complete the act on the way of it's respondent to every single thing

3 0
3 years ago
Whith regard to gender difference s in coping strategies, male is to female as fight or flight is to
Ann [662]
With regards to gender differences in coping strategies, male is to female as fight or flight is to TEND AND BEFRIEND. Men and women have different strategies in coping with stress; men usually exhibit the fight or flight tendency while women exhibit the tend and befriend tendency.
4 0
3 years ago
A phage is a virus that infects bacterial cells. A phage virus is shown above. What component of the phage virus is indicated by
Setler [38]

Answer:

<u>D) the nucleic acid (either DNA or RNA)</u>

<u />

Explanation:

Phages, or bacteriophages are viruses that infect bacteria.They have varying shapes, and sizes, and may contain one of two kinds of nucleic acid; these are RNA and DNA.

The nucleic acids  are made up of nucleotides. These are  genetic storage biomolecules made up of the monomers ribonucleic acid (RNA) deoxyribonucleic acid (DNA).

8 0
3 years ago
What is the relationship between these three structures?
Svet_ta [14]
The answer is <span>C. DNA controls the production of protein in the cell.

DNA is made up of nucleotides. The sequences of nucleotides carry information for the protein synthesis. DNA is stored inside the nucleus, one of the organelles present in all eukaryotic cells.</span>
7 0
3 years ago
Read 2 more answers
Which pattern describes the levels of biodiversity across the fossil record?
Leto [7]
Biodiversity generally refers to the variety and variability of life on Earth. According to the United Nations Environment Programme(UNEP), biodiversity typically measures variation at the genetic, species, and ecosystem level.[1] Terrestrial biodiversity tends to be greater near the equator,[2] which seems to be the result of the warm climateand high primary productivity.[3] Biodiversity is not distributed evenly on Earth, and is richest in the tropics. These tropical forest ecosystems cover less than 10 percent of earth's surface, and contain about 90 percent of the world's species.[4] Marine biodiversitytends to be highest along coasts in the Western Pacific, where sea surface temperature is highest, and in the mid-latitudinal band in all oceans. There are latitudinal gradients in species diversity.[5]Biodiversity generally tends to cluster in hotspots,[6] and has been increasing through time,[7][8] but will be likely to slow in the future.[9]

Rapid environmental changes typically cause mass extinctions.[10][11][12] More than 99.9 percent of all species that ever lived on Earth, amounting to over five billion species,[13] are estimated to be extinct.lstimates on the number of Earth's current species range from 10 million to 14 million,[f which about 1.2 million have been documented and over 86 percent have not yet been described] More recently, in May 2016, scientists reported that 1 trillion species are estimated to be on Earth currently with only one-thousandth of one percent described.[18]The total amount of related DNA base pairson Earth is estimated at 5.0 x 1037 and weighs 50 billion tonnes.[19] In comparison, the total mass of the biosphere has been estimated to be as much as 4 TtC (trillion tons of carbon).[20] In July 2016, scientists reported identifying a set of 355 genes from the Last Universal Common Ancestor (LUCA) of all organisms living on Earth.[21]

The age of the Earth is about 4.54 billion years.[22][23][24] The earliest undisputed evidence of life on Earth dates at least from 3.5 billion years ago,[25][26][27] during the Eoarchean Era after a geological crust started to solidify following the earlier molten HadeanEon. There are microbial mat fossils found in 3.48 billion-year-old sandstone discovered in Western Australia.[28][29][30] Other early physical evidence of a biogenic substance is graphite in 3.7 billion-year-old meta-sedimentary rocks discovered in Western Greenland.More recently, in 2015, "remains of biotic life" were found in 4.1 billion-year-old rocks in Western Australia.[32][33] According to one of the researchers, "If life arose relatively quickly on Earth .. then it could be common in the universe.

decreased and then increased after major waves of mass extinctions
Answer is.

4 0
3 years ago
Other questions:
  • The major site or organ in the body for metabolic processing of carbohydrates is the
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • An important part of science? Open-mindedness,skepticism,or both.
    10·2 answers
  • In traditional recombinant DNA technology, a desirable gene from one organism is inserted into the DNA of a host organism. Howev
    11·1 answer
  • The PCR reaction for Lab 2 is listed below. For each component besides water, briefly describe the component’s role in the PCR r
    13·1 answer
  • How do vertebrates take care of their young differently than invertebrates
    7·1 answer
  • I high of the following did the us government attempt to do during world war 1
    11·2 answers
  • The __________carries oxygen-poor venous blood from above the diaphragm from areas of the upper body and extremities into the ri
    7·1 answer
  • What is the density of a material that has the volume of 24.0 mL and a mass of 53.0 g
    12·1 answer
  • Helppppppp meeee please ​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!