3 years ago

As plates move past each other, stress builds up. What happens when this stress becomes too much?

1 answer:

7 0

Answer:

The rough edges of the plates get trapped on each other as they pass. This slows the motion on the border as the remaining plates continue to move. Pressure builds up, and when the plates get too much, the hard, fractured lithosphere breaks unexpectedly, possibly resulting in an earthquake.

I am joyous to assist you anytime.

You might be interested in

In an eukaryotic cell, mitosis is followed by ?

attashe74 [19]

After Mitosis the cell completes its division by splitting its cytopplasm and re-building the last line of its cell memebrane

5 0

3 years ago

A butterfly emerging from a cocoon is an example of which characteristic of life

lukranit [14]

Answer:

bio -characteristic of life

4 0

3 years ago

Read 2 more answers

Why are scientific theories often so powerful?

vodka [1.7K]

Scientific theories are often so powerful because they have been tested several time by different peoples and they have been found to be true. A scientific theory is a well substantiated explanation for a specific phenomenon which has undergone many observations and experiments and has stand the test of time. Thus, scientific theories always have to be reckon with because they have been severally tested.

4 0

3 years ago

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

Ierofanga [76]

<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)

6 0

3 years ago

Start the rock's journey anywhere you want, but be sure to have it go through all the processes of the rock cycle by the end of

Nitella [24]

Hiya,

Not sure how to answer this! Perhaps there is an image of the question or a lab you can attach to your question/comment so I can help you out?

Thanks.

8 0

3 years ago